Evaluasi Kuliah Kimia dan Masyarakat: kesan yang begitu hebat…

 

 

Tak terasa kuliah kimia dan masyarakat sudah selesai. Akhirnya saya bisa menjadi diri sendiri lagi, ”back to the nature”. Keadaan saya sekarang ini tidak kelihatan seperti orang yang rajin  seperti saat-saat kuliah kimia dan masyarakat. Menurut hemat saya, level tertinggi tingkat   ”kerajinan” saya adalah ketika mendalami ilmu dari kuliah kimia dan masyarakat. Di dalam kuliah tersebut saya dididik untuk menjadi pribadi yang rajin, sopan dalam berpakaian, dan datang tepat waktu.

Tapi sayangnya kuliah ini hanya berlangsung selama enam minggu, jadi level “kerajinan” tertinggi saya hanya bertahan selama 6 minggu, tepatnya sampai hari Senin tanggal 13 April 2009 sebelum batas  pengumpulan resume terakhir. Saya hanya bisa rajin selama enam minggu tetapi tidak apa-apa, toh hal tersebut membuat saya setidaknya pernah di-cap oleh teman-teman non-honours sebagai orang yang pernah rajin.

Menurut saya, kuliah kimia dan masyarakat waktunya kurang buat saya. Soalnya waktu selama 6 minggu belum bisa membuat saya menjadi rajin secara “permanen”. Menurut istilah kimianya waktu 6 minggu belum bisa melampaui energi aktivasi tingkat “kerajinan” saya. Jadi kalau misalkan kuliah masyarakat dilakukan selama satu semester, saya yakin energi selama enam bulan dapat melampaui energi aktivasi “kerajinan” saya. Kalau kuliah ini dilakukan selam enam bulan saya akan menjadi mahasiswa yang “rajin permanen”. Jadi mahasiswa yang baru, dan semangat yang baru pula, saya yakin itu.

Tetapi saya merasa bersyukur meskipun hanya cuma 6 minggu, saya merasa beruntung, saya mendapat banyak pelajaran. Saya berharap suatu saat nanti bisa menaikan level saya dari pemalas menjadi perajin  maksud saya orang yang rajin. Tentunya saya berharap bukan tugas resume lagi yang menguji saya tetapi ujian lain yang lebih menantang.

Pada awalnya, saya sangat malas untuk mengikuti kuliah ini. Saya menganggap bahwa kuliah ini sangat tidak berguna karena waktunya yang sangat lama dan tugas yang diberikan sangat berat. Namun pikiran itu kini telah berubah. Pada kuliah pertama dengan Ibu Mega, saya masih menganggap kuliah ini tidak berguna dan hanya membuang-buang waktu saja.

Namun, setelah mengikuti kuliah pertama dengan Bapak Eri pikiran tersebut perlahan-lahan mulai berubah. Saya mulai menyadari pentingnya kuliah ini. Kemudian seiring dengan berjalannya waktu saya kini sangat menyukai kuliah ini meskipun banyak menyita waktu dan tugasnya sangat berat. Tugas kuliah kimia dan masyarakat cukup sederhana yaitu membuat resume sebanyak sepuluh halaman, spasi tunggal, jenis huruf Trebucht MS, dan ukuran huruf 11. Walaupun demikian kuliah ini memberikan ilmu yang sangat dahsyat bagi saya.

Kuliah ini sempat membuat entropi kehidupan saya meningkat, sangat menghabiskan waktu, penuh kesibukan apalagi setiap malam Jumat saya harus begadang ataupun tidak tidur sama sekali demi menghasilkan 10 lembar resume kuliah. Buat saya itu adalah sebuah keuntungan dan bukan kerugian apalagi saya belum terbiasa belajar menulis dengan baik.

Tulisan saya dapat dibedakan dari tulisan yang lainnnya yaitu tidak dapat dibedakan mana subjek, predikat dan objeknya. Tetapi hal tersebut saya rasa wajar saja, karena merupakan proses belajar. Sama dengan kuliah kimia dan masyarakat yaitu berguru kepada orang-orang yang sudah berpengalaman dan ahli dalam bidangnya. Saya sangat beruntung sekali.

Saya sempat down setiap mau menginjak malam Jumat. Ketakutan itu semakin mencekam menjelang tengah malam. Ketakutan itu biasanya terjadi karena sampai jam tersebut saya belum bisa mendapatkan ide untuk menulis resume. Ada dua pilihan ketika menunggu detik-detik tengah malam jumat yaitu saya tertidur karena tidak mendapatkan inspirasi menulis dan dilanjutkan hari esoknya atau terus “bertapa” sampai fajar pagi menjelang apabila saya mendapatkan ide cemerlang.

Jam-jam tersebut sangat menentukan bagi saya karena menyangkut hidup dan kehidupann saya. Tapi yang lebih hebatntya lagi biasanya saya mendapatkan inspirasi brilian ketika  mendekati detik-detik yang menentukan itu dan tidak sampai hari esoknya mengerjakan resume kimas. Menurut saya itu adalah suatu pencapaian yang luar biasa yang pernah saya capai selama kehidupan saya.

Adanya ketegangan, ketakutan, kecemasan dan semburan adrenalin yang memancar melewati urat nadi, membuat saya merasa semua itu mengandung pelajaran yang berharga. Saya berpikir bahawa hal tersebut akan menjadi masa lalu pada akhirnya dan memberikan manfaat yang sangat berharga.

Menghadapi tugas resume, saya harus  menyingkirkan paradigma yang jelek tentang rasa malas dan rasa bosan. Saya harus grow up dan tetap survive apapun tugasnya. Saya berpendapat bahwa ilmu yang saya peroleh itu akan bermanfaat pada suatu saat nanti walaupun sebenarnya tidak berkaitan dengan interest saya. Suatu saat ilmu dari matakuliah kimia & masyarakat pasti memberikan manfaat ketika kita berhadapan di dunia kerja. Walupun tidak secara langsung, tetapi  kegigihan kita untuk bagaimana mempelajari hal-hal yang baru, bertahan dengan sesuatu yang sama sekali tidak suka, membalikan paradigma yang salah dan lain-lain itu adalah sesuatu yang bermanfaat pada suatu saat nanti.

Saya mendapat banyak hal yang berharga dari perkuliahan ini diantaranya pentingnya menghargai waktu. Pikiran saya sebelumnya tentang waktu adalah bahwa waktu adalah milik saya sepenuhnya, orang lain tidak berhak menggangu hak paling berharga saya. Saya berpikir bahwa orang lain harus mengikuti siklus waktu saya.

Tapi kenyataannya dalam siklus waktu itu terdapat hak orang lain untuk menggunakan waktunya. Dan sangat keterlaluan sekali apabila saya bersikap diktator terhadap pengguanan waktu ini. Dalam kuliah ini saya mendapatkan pelajaran bahwa saya harus menghargai waktu yang diberikan orang lain untuk saya. Jadi selama perkuliahan ini saya berusaha untuk tepat pada waktunya. Saya harus datang paling awal dibandingkan dengan teman-teman yang lainnya. Saya ingin membuktikan dedikasi saya terhadap waktu dimulai dengan menghadiri kuliah kimia dan masyarakat tepat waktu dan mengumpulkan resume sesuai dengan jadwal yang telah diberlakukan. Untuk urusan waku ini saya  bisa meyakinkan diri sendiri bahwa saya adalah orang yang bisa menghargai waktu.

Selain itu saya mendapat pelajaran bahwa saya harus menghindari kesalahan-kesalahan kecil, diantaranya dengan berusaha mengurangi kesalahan mengetik. Saya cukup surprise juga bahwa dedikasi Bu Mega terhadap perkuliahan ini sangat besar. Saya belum bisa membayangkan bahwa dengan kesibukan Bu Mega yang “seabrek” itu masih sempat juga memeriksa resume kami sampai se-detail mungkin. Sampai-sampai kesalahan pengetikan setiap mahasiswa  dihitung, hebat sekali menurut saya.

Untuk urusan ini saya belum bisa menyamai Bu Mega. Buktinya saja, kalau misalkan saya memeriksa laporan dari praktikan yang saya asisteni, saya hanya bisa memeriksa dengan metode scanning, artinya cukup dilihat dari ketebalannya tanpa melihat substansinya apalagi kesalahan pengetikannya. Saya salut sekali dengan Bu Mega, saya juga ingin seperti itu.

Pelajaran mengenai orientasi pada detail sangat berguna sekali di dalam dunia kerja. Karena menurut Mas Oho yaitu salah seorang tamu pada kuliah kimia dan masyarakat berpendapat bahawa dunia kerja kompleksitasya jauh-jauh berbeda dibandingkan dengan perkuliahan. Makanya kita harus siap dengan hal-hal seperti itu. Satu hal lagi yang saya peroleh dari  Mas Oho  yaitu di dunia kerja tidak ada namanya kesalahan semuanya harus dilakukan dengan benar dan tidak boleh salah, berbeda  dengan perkuliahan yang masih ada pengampunan. Jadi kita harus tetap siap walaupun level kita harus turun sampai ke dasar  karena akibat kesalahan kita. Oleh karena itu kita harus berorinetasi pada hal-hal yang biasa dianggap remeh.

Menurut saya kuliah ini sangat penting bukan hanya bagi mahasiswa akan tetapi juga bagi mahasiswa non-honours lainnya. Saya sangat setuju sekali jika kuliah ini dijadikan kuliah wajib bagi seluruh mahasiswa kimia. Karena menurut saya sangat tidak adil sekali jika kuliah ini hanya diwajibkan bagi mahasiswa honours karena kuliah ini tidak memerlukan sarana dan prasarana  yang besar. Akan tetapi akan lebih baik jika waktu kuliahnya dikurangi terutama pada saat evaluasi dari Ibu Mega dan jumlah pertemuan ditambah dan tugas dikurangi. Evaluasi dari Ibu Mega meskipun sangat penting tetapi tidak perlu panjang lebar. Evaluasi dari Ibu Mega menunjukkan bahwa Ibu Mega menghargai hasil kerja keras kami.

Menurut saya, kurikulum di Program Studi Kimia ITB kurang memperhatikan mengenai soft skill. Menurut saya mahasiswa kimia lebih banyak “terpenjara” di laboratorium untuk melakukan praktikum dan kurang mendapatkan materi yang berguna saat lulus nanti dan terjun di masyarakat dan industri.

Saran saya yang lain adalah agar dosen pengajar yang didatangkan tidak hanya dari alumnus Kimia ITB, tetapi juga dari luar ITB misalnya dari intansi pemerintahan agar lebih membuka wawasan kami.

Pada perkuliahan yang lalu, pembicaranya sudah cukup baik yaitu tidak hanya berasal dari alumnus kimia tetapi ada pebicara yang berasal dari bidang yang sama sekali tidak berkaitan secara langsung  dengan kimia. Misalakan saja kedatangna Pak Nanang yang membuka wawasan tentang LSM dan Pak Eri yang membawakan kuliah tentang komunikasi. Saya sangat menikmati sekali kuliah dengan pak Eri dan Pak Nanang karena bidangnya jauh dari jangkauan keilmun saya. Jadi saya bisa belajar lebih banyak dari beliau.

Tetapi saran saya untuk kedepan, tidak ada salahanya kalau dosen tamu yang berasal dari non-kimia diperbanyak dan pematerinya itu di-update. Artinya menurut saya alangkah lebih baik apabila dosen tamu yang bukan berasal dari kimia terkait dengan kejadian yang sedang hangat-hangatmya. Misalkan saja pada saat pemilu, kita bisa mendatangkan tokoh politik atau para caleg. Dari mereka setidaknya kita mengetahui tentang ilmu pemerintahan. Menurut saya masih banyak dosen tamu non-kimia yang kompeten untuk didatangkan pada kuliah kimia dan masyarakat.

Ibu Megawati Santoso sebagai dosen kuliah telah melakukan tugasnya dengan sangat baik sekali. Beliau mengajarkan kami banyak hal yang tidak kami dapatkan saat kuliah lainnya. Beliau sangat konsisten dengan apa yang beliau katakan misalnya mengenai keterlambatan. Beliau melarang kami terlambat dan beliau juga datang tepat waktu, bahkan jauh sebelum kuliah dimulai. Saya sangat menghargai sekali dengan dedikasi beliau. Semoga saja saya bisa mengikutinya.

Khusus untuk Pak Sarwono saya tidak bisa berbicara panjang lebar. Karena saya belum bisa merasakan “sihir” beliau yang bisa membuat Mas Oho dan Pak Gilbert menjadi orang yang sukses. Menurut pengakuan Mas Oho dan Pak Gilbert, sosok Pak Sarwono ini bisa memberikan motivasi yang sangat berharga pada mahasiswanya sehingga bisa termotivasi untuk membuat suatu karya terbaik.

Untuk Pak Sarwono saya jujur saya belum merasakan “sihir” Bapak. Tetapi suatu saat nanti saya bisa merasakan sihir Pak Sarwono. Mungkin pada saat semester akhir saya bisa mengikuti kuliah beliau dengan mengikuti kuliah Biokimia Pangan. Saya sangat mengaharapkan sekali pesan-pesan yang sangat berharga dari orang tua seperti Pak Sarwono karena menurut saya pesan-pesan yang diutarakan oleh Pak Sarwono ini adalah pesan-pesan yang timbul dari pengalaman hidupnya, bukan pesan-pesan yang semata-mata berasal dari teori saja atau buku-buku motivasi.  Saya sangat menantikan sekali Pak.

Sekian saja kesan dan saran dari saya. Semoga saja setelah mengikuti pendidikan yang sangat berharga selama enam minggu ini saya bisa menjadi pribadi yang lebih baik dan bisa melaju ke level yang lebih tinggi lagi. Terimakasih Bu Mega termakasih Pak Sarwono, terimakasih teman-teman.

Industri Berwawasan Lingkungan

Hari ini adalah hari  Minggu tanggal 12 Maret 2009 tepatnya malam Senin jam 7.28 malam. Hal yang spesial  dari malam-malam sebelumnya  yaitu karena malam ini saya harus menyelesaikan resume kuliah  kimia dan masyarakat minggu ke enam . Resume ini adalah resume terakhir yang harus saya buat dan harus selesai pada hari ini juga karena harus  dikumpulkan besok sekitar jam 3 sore.

Sampai saat ini saya belum mendapatkan ide brilian untuk memulai kata-kata pilihan dalam menulis kalimat pertama. Mungkin saja karena sedikit terlupakan akibat libur selama empat hari membuat saya susah berada pada level  berpikir yang seharusnya.  Ternyata adanya hari libur itu tidak lebih baik daripada hari-hari biasanya untuk mengerjakan resume karena bisanya ide untuk menulis resume kuliah kimia dan masyarakat  tidak macet seperti ini.

Ide brilian biasanya muncul  ketika saya terdesak atau terjepit, tapi tidak mungkin juga saya harus menunggu sampai besok jam 12 siang untuk mendapatkan ide-ide brilian.

Hari ini terasa sulit menulis resume kimia dan masyarakat sebanyak 10 halaman ditambah  tiga lembar evaluasi kuliah secara keseluruhan dengan mengguanakan jenis huruf Trebuchet MS dengan ukuran huruf 11. Dalam hati saya muncul pikiran bagaimana caranya untuk menulis sekedar kalimat pertama resume.

Akhirnya ide untuk memunculkan ide brilian muncul  juga. Saya teringat ketika dulu mengalami hal-hal yang sulit biasanya saya minum kopi terlebih dahulu, kebetulan di laci masih ada sebungkus Nescafe original oleh-oleh dari Pak Gilbert Sinamo  dan kawan-kawan dari Lampung.

Setelah meneguk secangkir kopi akhirnya saya teringat beberapa kejadian menarik Jumat lalu ketika perkuliahan kimia dan Masyarakat yang dibawakan oleh Pak Gilbert, Pak Jatmiko dan Pak Suryadi.  Pada hari itu Pak Gilbert membawakan kuliah yang cukup menarik yaitu sekilas tentang  industri kopi Nestle dengan merek Nescafe yang berada di Lampung. Selain itu juga saya teringat dengan pembicara yang kedua yaitu Pak Jatmiko yang memberikan kuliah mengenai industri dan kaitannya dengan dampak lingkungan.

Akhirnya setelah mengingat-ngingat kejadian pada Jumat lalu terlintas juga dalam pikiran saya untuk menulis resume tentang  industri dan kaitannya dengan pencemaran lingkungan. Akhirnya dengan hanya segelas kopi saya bisa memulai menulis kalimat pertama.

Dalam resume ini saya akan membahas mengenai dampak industri terhadap lingkungan, selanjutnya akan dibahas mengenai  jenis-jenis limbah yang dihasilakan oleh industri, lalu akan dibahas juga mengenai  dampak pencemaran  yang dihasilkan oleh industri dan yang terakhir adalah bagaimana peran pemerintah sebagai pengambil kebijakan agar semua industri menerapkan sistem yang  berwawasan lingkungan.

Dampak Industri Terhadap Lingkungan

Pertama-tama saya akan   membahas mengenai dampak lingkungan yang dihasilkan  dari proses industri. Hal ini perlu dicermati karena di Indonesia masih banyak industri yang belum bisa menerapkan sistem yang ramah terhadap lingkungan. Industri seperti ini menyebakan pencemaran terhadap lingkungan yang secara langsung atau tidak langsung menyebabkan kerugian bagi lingkungannya baik itu penduduk yang tinggal disekitar kawasan industri atau dampak terhadap kerusakan lingkungan daerah sekitarnya.

Permasalahan lingkungan hidup telah menjadi suatu penyakit kronis yang dirasa sangat sulit untuk dipulihkan. Pada zaman orde baru, pembangunan diarahkan dari sektor agraris kemudian beralih ke sektor industri.  Selama 20 tahun terakhir pembangunan ekonomi Indonesia mengarah kepada industrialisasi. Tidak kurang terdapat 30.000 industri yang beroperasi di Indonesia dari tahun ke tahun menunjukkan peningkatan (Suardana, 2008). Peningkatan jumlah ini menimbulkan dampak ikutan dari industrialisasi ini yaitu terjadinya peningkatan dampak dari hasil buangan industri ini dirasakan sekarang ini.

Pencemaran air, udara, tanah dan pembuangan limbah bahan berbahaya dan beracun (B3) dihasilkan dari proses produksi industri. Salah satu penyebab yang terjadi karena pemerintah dan pelaku industri kurang mengedepankan sektor lingkungan. Akibatanya merupakan persoalan yang harus dihadapi oleh komunitas-komunitas yang tinggal di sekitar kawasan industri.

Limbah industri umumnya berupa bahan sintetik, logam berat, bahan beracun berbahaya yang sulit untuk diurai oleh proses biologi (nondegradable) selain itu limbah industri bersifat menetap dan mudah terakumulasi (biomagnifikasi) bahkan logam berat sebagai sebuah unsur memiliki kodrat menetap di alam tidak dapat dihilangkan.

Sedangkan limbah domestik umumnya tersusun atas limbah organik, jenis limbah ini dapat terurai menjadi zat-zat yang tidak berbahaya dan dapat dihilangkan dari perairan dengan proses biologis alamiah (biodegradable), proses kimia dan fisika. Selain itu yang perlu dikawatirkan adalah dampak limbah industri terhadap lingkungan dan kesehatan manusia. Limbah industri yang bersifat nonbiodegradable berbahaya terhadap kesehatan manusia karena beberapa unsur logam berat seperti merkuri memiliki sifat toksik dan destruktif terhadap organ penting manusia.

Akibat lalainya Pemerintah dalam melakukan kontrol terhadap industri maka sumber pencemar kandungan logam berat seperti merkuri di air setiap tahun mengalami peningkatan. Dari aspek pengendalian sebenarnya limbah cair industri lebih mudah untuk dipantau dan dikendalikan karena lokasinya yang terpusat (point source) sebaliknya limbah domestik letaknya yang tersebar (disperse source).

Gambar : Limbah industri mengalir meracuni bahan air minum warga Surabaya

Sumber: (Prigi Arisandi, 2004)

Gejala umum pencemaran lingkungan akibat limbah industri yang segera tampak adalah berubahnya keadaan fisik. Air sungai  atau air sumur sekitar lokasi industri  pencemar, yang semula berwarna jernih, berubah menjadi keruh berbuih dan terbau busuk, sehingga tidak layak dipergunakan lagi oleh warga masyarakat sekitar untuk mandi, mencuci, apalagi untuk bahan baku air minum. Terhadap kesehatan warga masyarakat sekitar dapat timbul penyakit dari yang ringan seperti gatal-gatal pada kulit sampai yang berat berupa cacat genetik pada anak cucu dan generasi berikutnya.

Parahnya lagi, penyakit akibat pencemaran ada yang baru muncul sekian tahun kemudian setelah cukup lama bahan pencemar terkontaminasi dalam bahan makanan menurut daur ulang ekologik, seperti yang terjadi pada kasus penyakit minamata sekitar 1956 di Jepang. Terdapat lebih dari 100 orang meninggal atau cacat karena mengkonsumsi ikan yang berasal dari Teluk Minamata. Teluk ini tercemar merkuri yang berasal dari sebuah pabrik plastik. Bila merkuri masuk ke dalam tubuh manusia melalui saluran pencernaan, dapat menyebabkan kerusakan akut pada ginjal sedangkan pada anak-anak dapat menyebabkan Pink Disease/ acrodynia, alergi kulit dan kawasaki disease/mucocutaneous lymph node syndrome (Suardana, 2008).

Hampir di seluruh wilayah Indonesia terjadi pencemaran industri dalam berbagai skala dan dalam beragam bentuk. Sejak awal berdiri, sektor industri seringkali menimbulkan masalah, misalnya, lokasi pabrik yang dekat dengan pemukiman penduduk, pembebasan tanah yang bermasalah, tidak dilibatkannya masyarakat dalam kebijakan ini, buruknya kualitas AMDAL, sering tidak adanya pengolahan limbah, dan lain sebagainya. Dampak lainnya yang timbul adalah polusi udara, polusi air, kebisingan, dan sampah. Semua dampak tersebut menjadi faktor utama penyebab kerentanan yang terjadi dalam masyarakat. Kehidupan masyarakat menjadi tambah rentan karena buruknya kualitas lingkungan.

Beberapa fakta yang disebabakan buruknya penanganan terhadap lingkungan yang berasal dari sektor industri antara lain (Suardana, 2008):

  • Sulawesi-kasus pencemaran Teluk Buyat, dugaan pencemaran Teluk Buyat akibat dari pembuangan limbah tailing (submarine tailing disposal).
  • Dugaan yang sama terhadap perairan Laut Lombok Timur akibat operasi PT. Newmont Nusa Tenggara (PT.NTT) NTB.
  • Papua; PT. Freeport beroperasi dari tahun 1967 telah menimbulkan dampak Hancurnya Gunung Grasberg,  tercemarnya Sungai Aigwa, meluapnya air Danau Wanagon, tailing mengkontaminasi : 35.820 hektar daratan dan 84.158 hektar Laut Arafura.
  • Di Kalimantan Selatan, pembuangan limbah industri ke aliran sungai oleh PT Galuh Cempaka.
  • Kalimantan Tengah; tiga sungai besar di Kalimantan Tengah masih tercemar air raksa (merkuri) akibat penambangan emas di sepanjang daerah aliran sungai (DAS) Barito, Kahayan, dan Kapuas. Pencemaran itu melebihi baku mutu yang dipersyaratkan.
  • Di Jawa, Pembuangan limbah pabrik-pabrik di Sungai Cikijing selama puluhan tahun (Jawa Barat).
  • Pembuangan limbah oleh beberapa pabrik ke kali Surabaya, dan sederetan kasus pencemaran industri yang telah nyata-nyata menimbulkan korban.
  • Kasus lumpur lapindo yang diakibatkan keteledoran pihak industri menyebabkan ribuan rumah warga terendam lumpur. Selain itu aliran lumpur yang melewati Sungai Porong menyebabkan kerusakan vegetasi sekitarnya dan pencemaran lingkungan.

Gambar : Semburan lumpur Lapindo

http://www.greenpeace.org/raw/image_full/seasia/en/photosvideos/photos/view-of-the-mud-gushing-out-of.jpg

Indikasi Pencemaran Lingkungan

Jenis-jenis pencemaran yang disebabkan oleh industri antara lain pencemaran air, udara, tanah, dan limbah bahan berbahaya dan beracun (B3). Gejala pencemaran lingkungan dapat dilihat dari parameter fisik dan kimia. Indikasi secara fisik dan kimia dari pencemaran air misalnya dapat dilihat dari parameter-parameter fisika dan kimia. Parameter fisika dan kimia yang ditimbulkan dari penecemaran itu menyebabkan perubahan-perubahan yang cukup signifikan dibandingkan dengan kondisi normalnya.  Perubahan pada parameter ini menimbulkan perubahan pH, perubahan warna, bau, rasa dan timbulnya endapan (http://id.wikipedia.org/wiki/Limbah).

  1. Perubahan pH (tingkat keasaman / konsentrasi ion hidrogen). Air normal yang memenuhi syarat untuk suatu kehidupan memiliki pH netral dengan kisaran nilai 6.5 – 7.5. Air limbah industri yang belum terolah dan memiliki pH diluar nilai pH netral, akan mengubah pH air sungai dan dapat mengganggu kehidupan organisme di dalamnya. Hal ini akan semakin parah jika daya dukung lingkungan rendah serta debit air sungai rendah. Limbah dengan pH asam/rendah bersifat korosif terhadap logam.
  2. Perubahan warna, bau dan rasa. Air normal dan air bersih tidak akan berwarna, sehingga tampak bening/jernih. Bila kondisi air warnanya berubah maka hal tersebut merupakan salah satu indikasi bahwa air telah tercemar. Timbulnya bau pada air lingkungan merupakan indikasi kuat bahwa air telah tercemar. Air yang bau dapat berasal dari limbah industri atau dari hasil degradasi oleh mikroba. Mikroba yang hidup dalam air akan mengubah organik menjadi bahan yang mudah menguap dan berbau sehingga mengubah rasa.
  3. Timbulnya endapan, koloid dan bahan terlarut. Endapan, koloid dan bahan terlarut berasal dari adanya limbah industri yang berbentuk padat. Limbah industri yang berbentuk padat, bila tidak larut sempurna akan mengendap di dasar sungai, dan yang larut sebagian akan menjadi koloid dan akan menghalangi bahan-bahan organik yang sulit diukur melalui uji BOD karena sulit didegradasi melalui reaksi biokimia, namun dapat diukur melalui uji COD.

Kronisnya permasalahan lingkungan hidup terutama menyangkut pencemaran industri yang selama ini terjadi di Indonesia sepertinya tidak memberikan pelajaran yang berarti bagi Negara, minimal berbenah untuk melakukan  tindakan-tindakan secara komprehensif dalam menangani pencemaran oleh limbah industri.

Kebijakan Pemerintah Lebih Mengedepankan Profit Daripada Aspek Lingkungan

Massifnya pencemaran limbah industri dalam beberapa dekade menyebabkan tidak diperlukannya keahlian khusus untuk mengetahui akar persoalan dari tidak tuntasnya penanganan pencemaran limbah industri ini. Secara gamblang dapat dikatakan bahwa  paradigma pembangunan yang mementingkan pertumbuhan ekonomi dan mengabaikan faktor lingkungan yang dianggap sebagai penghambat adalah faktor utama dari masalah ini. Posisi tersebut menyebabkan terabaikannya pertimbangan-pertimbangan lingkungan hidup di dalam pengambilan keputusan dan pembuatan kebijakan. Akibatnya kualitas lingkungan makin hari semakin menurun, ditandai dengan terjadinya pencemaran dan perusakan lingkungan hidup di berbagai wilayah di Indonesia.

Penanganan limbah industri di Indonesia kerapkali mengabaikan standar penanganan limbah industri yang aman bagi kelangsungan lingkungan hidup. Misalnya, perusahaan tambang yang menerapkan pembuangan limbah tailingnya ke laut (sub marine tailing disposal). Pertama, adalah Newmont Minahasa Raya (NMR) sejak 1996 di Kabupaten Minahasa, Sulawesi Utara, dan kemudian menyusul PT Newmont Nusa Tenggara (NNT) di Sumbawa-Nusa Tenggara Barat sejak 1999. Setiap harinya 2.000 metrik ton tailing berbentuk pasta dibuang ke Perairan Buyat di Minahasa dan 120.000 metrik ton di Teluk Senunu, Sumbawa. Pada akhirnya dari proses ini terjadi berbagai dampak yang berujung kepada turunnya kualitas lingkungan hidup dan kualitas hidup manusia (Suardana, 2008).

Sampai hari ini belum terlihat upaya serius dari seluruh jajaran pemerintah dalam mengatasi permasalahan tersebut. Dalam hal kasus-kasus pencemaran tidak terlihat adanya penegakan hukum bagi perusahaan pencemar yang  ada justru adalah viktimisasi terhadap korban pencemaran limbah industri. Lemahnya pemahaman aparat penegak hukum seperti kepolisian dan pengadilan mengenai peraturan perundangan lingkungan hidup termasuk pula lemahnya penegakan hukum menjadikan penanganan limbah industri ini tidak akan tuntas.

Keadaan ini disebabkan karena Negara menutup akses rakyat atas informasi yang terkait dengan industri dan  termasuk limbah industri. Tidak dilibatkannya masyarakat secara maksimal dalam pengelolaan lingkungan sehingga seolah-olah urusan lingkungan hanya menjadi urusan pemerintah dan perusahaan tidak menjadi urusan publik sebagai pihak yang banyak menggunakan jasa lingkungan.

Teknologi Pengolahan Air Limbah

Untuk mengatasi dampak lingkungan yang dihasilkan lebih buruk maka diperlukan suatu teknologi pengolahan limbah. Dengan kemajuan ilmu pengetahuan dan teknologi maka sekarang dapat diketahui mengenai cara pengolahan limbah yang baik dan benar. Salah satu pengolahan limbah yang akan dijelaskan pada resume ini diantaranya  mengenai teknologI pengolahan limbah cair. Limbah cair merupakan limbah yang dampaknya dapat dirasakan secara langsung sehingga perlu dibahas secara integratif mengenai penanganan limbah cair.

Pembuangan air limbah baik yang bersumber dari kegiatan domestik (rumah tangga) maupun industri ke badan air dapat menyebabkan pencemaran lingkungan apabila kualitas air limbah tidak memenuhi baku mutu limbah.

Gambar : Sebuah trickling filter bed yang menggunakan plastic media.

Sumber : http://majarimagazine.com/wp-content/uploads/2008/01/250px-trickling_filter_bed_2_w.JPG

Bagaimana dengan air limbah industri? Dalam kegiatan industri, air limbah akan mengandung zat-zat/kontaminan yang dihasilkan dari sisa bahan baku, sisa pelarut atau bahan aditif, produk terbuang atau gagal, pencucian dan pembilasan peralatan, blowdown beberapa peralatan seperti kettle boiler dan sistem air pendingin, serta sanitary wastes. Agar dapat memenuhi baku mutu, industri harus menerapkan prinsip pengendalin limbah secara cermat dan terpadu baik di dalam proses produksi (in-pipe pollution prevention) dan setelah proses produksi (end-pipe pollution prevention). Pengendalian dalam proses produksi bertujuan untuk meminimalkan volume limbah yang ditimbulkan, juga konsentrasi dan toksisitas kontaminannya. Sedangkan pengendalian setelah proses produksi dimaksudkan untuk menurunkan kadar bahan pencemar sehingga pada akhirnya air tersebut memenuhi baku mutu yang sudah ditetapkan.

Batasan Air Limbah untuk Industri

Tabel dibawah ini berisi mengenai daftar parameter yang harus diperhatikan oleh para pelaku industri.

Parameter Konsentrasi (mg/L)
COD 100 – 300
BOD 50 – 150
Minyak nabati 5 – 10
Minyak mineral 10 – 50
Zat padat tersuspensi (TSS) 200 – 400
Ph 6.0 – 9.0
Temperatur 38 – 40 [oC]
Ammonia bebas (NH3) 1.0 – 5.0
Nitrat (NO3-N) 20 – 30
Senyawa aktif biru metilen 5.0 – 10
Sulfida (H2S) 0.05 – 0.1
Fenol 0.5 – 1.0
Sianida (CN) 0.05 – 0.5


Sumber : Kepmen LH No. KEP-51/MENLH/10/1995

Namun walaupun begitu, masalah air limbah tidak sesederhana yang dibayangkan karena pengolahan air limbah memerlukan biaya investasi yang besar dan biaya operasi yang tidak sedikit. Untuk itu, pengolahan air limbah harus dilakukan dengan cermat, dimulai dari perencanaan yang teliti, pelaksanaan pembangunan fasilitas instalasi pengolahan air limbah (IPAL) atau unit pengolahan limbah (UPL) yang benar, serta pengoperasian yang cermat.

Dalam pengolahan air limbah itu sendiri, terdapat beberapa parameter kualitas yang digunakan. Parameter kualitas air limbah dapat dikelompokkan menjadi tiga, yaitu parameter organik, karakteristik fisik, dan kontaminan spesifik. Parameter organik merupakan ukuran jumlah zat organik yang terdapat dalam limbah. Parameter ini terdiri dari total organic carbon (TOC), chemical oxygen demand (COD), biochemical oxygen demand (BOD), minyak dan lemak (O&G), dan total petrolum hydrocarbons (TPH). Karakteristik fisik dalam air limbah dapat dilihat dari parameter total suspended solids (TSS), pH, temperatur, warna, bau, dan potensial reduksi. Sedangkan kontaminan spesifik dalam air limbah dapat berupa senyawa organik atau inorganik (Hidayat, 2008).

Pengolahan Air Limbah

Tujuan utama pengolahan air limbah ialah untuk mengurai kandungan bahan pencemar di dalam air terutama senyawa organik, padatan tersuspensi, mikroba patogen, dan senyawa organik yang tidak dapat diuraikan oleh mikroorganisme yang terdapat di alam. Pengolahan air limbah tersebut dapat dibagi menjadi 5 (lima) tahap (Hidayat, 2008):

  1. Pengolahan Awal (Pretreatment)
    Tahap pengolahan ini melibatkan proses fisik yang bertujuan untuk menghilangkan padatan tersuspensi dan minyak dalam aliran air limbah. Beberapa proses pengolahan yang berlangsung pada tahap ini ialah screen and grit removal, equalization and storage, serta oil separation.
  2. Pengolahan Tahap Pertama (Primary Treatment)
    Pada dasarnya, pengolahan tahap pertama ini masih memiliki tujuan yang sama dengan pengolahan awal. Letak perbedaannya ialah pada proses yang berlangsung. Proses yang terjadi pada pengolahan tahap pertama ialah neutralization, chemical addition and coagulation, flotation, sedimentation, dan filtration.
  3. Pengolahan Tahap Kedua (Secondary Treatment)
    Pengolahan tahap kedua dirancang untuk menghilangkan zat-zat terlarut dari air limbah yang tidak dapat dihilangkan dengan proses fisik biasa. Peralatan pengolahan yang umum digunakan pada pengolahan tahap ini ialah activated sludge, anaerobic lagoon, tricking filter, aerated lagoon, stabilization basin, rotating biological contactor, serta anaerobic contactor and filter.
  4. Pengolahan Tahap Ketiga (Tertiary Treatment)
    Proses-proses yang terlibat dalam pengolahan air limbah tahap ketiga ialah coagulation and sedimentation, filtration, carbon adsorption, ion exchange, membrane separation, serta thickening gravity or flotation.
  5. Pengolahan Lumpur (Sludge Treatment)
    Lumpur yang terbentuk sebagai hasil keempat tahap pengolahan sebelumnya kemudian diolah kembali melalui proses digestion or wet combustion, pressure filtration, vacuum filtration, centrifugation, lagooning or drying bed, incineration, atau landfill.

Pemilihan proses yang tepat didahului dengan mengelompokkan karakteristik kontaminan dalam air limbah dengan menggunakan indikator parameter yang sudah ditampilkan pada tabel di atas. Setelah kontaminan dikarakterisasikan, diadakan pertimbangan secara detail mengenai aspek ekonomi, aspek teknis, keamanan, kehandalan, dan kemudahan pengoperasian. Pada akhirnya, teknologi yang dipilih haruslah teknologi yang tepat guna sesuai dengan karakteristik limbah yang akan diolah. Setelah pertimbangan-pertimbangan detail, perlu juga dilakukan studi kelayakan atau bahkan percobaan skala laboratorium yang bertujuan untuk (Hidayat, 2008):

  1. Memastikan bahwa teknologi yang dipilih terdiri dari proses-proses yang sesuai dengan karakteristik limbah yang akan diolah.
  2. Mengembangkan dan mengumpulkan data yang diperlukan untuk menentukan efisiensi pengolahan yang diharapkan.
  3. Menyediakan informasi teknik dan ekonomi yang diperlukan untuk penerapan skala sebenarnya.

Gambar : Sebuah primary sedimentation tank di sebuah unit pengolahan limbah domestik.

Sedimentation tank merupakan salah satu unit pengolahan limbah yang sangat umum digunakan.

Sumber: http://majarimagazine.com/2008/01/teknologi-pengolahan-air-limbah/

Perlu kita semua sadari bahwa limbah tetaplah limbah. Solusi terbaik dari pengolahan limbah pada dasarnya ialah menghilangkan limbah itu sendiri. Produksi bersih (cleaner production) yang bertujuan untuk mencegah, mengurangi, dan menghilangkan terbentuknya limbah langsung pada sumbernya di seluruh bagian-bagian proses dapat dicapai dengan penerapan kebijaksanaan pencegahan, penguasaan teknologi bersih, serta perubahan mendasar pada sikap dan perilaku manajemen.

Kebijakan Pemerintah Dalam Penegakan Hukum Lingkungan

Lingkungan hidup yang sehat dan bersih adalah hak asasi manusia. Namun yang terjadi justru makin turunnya kualitas lingkungan hidup. Karenanya limbah industri harus ditangani dengan baik dan serius oleh pemerintah dengan mengawasi sungguh-sungguh. Sementara bagi pelaku industri harus melakukan cara-cara pencegahan pencemaran lingkungan dengan melaksanakan teknologi bersih, memasang alat pencegahan pencemaran, melakukan proses daur ulang. Yang paling penting adalah pelibatan masyarakat dalam pengawasan pengolahan limbah buangan industri agar lebih intens dalam menjaga mutu lingkungan hidup. Ikhtiar ini merupakan salah satu bentuk partisipasi dan pengawasan untuk memelihara kelestarian lingkungan hidup.

Namun demikian, persoalan limbah industri akan makin komplek dimasa mendatang. Penanganan limbah industri tidak akan pernah bisa efektif dalam menjamin kelangsungan lingkungan hidup termasuk pula akan mampu menjamin derajat hidup manusia secara maksimal bilamana Negara masih “setia” dengan paradigma lama yang selalu tidak berkutik di depan “modal”. Permasalahan ini akan makin kompleks saat ini karena industri lebih terfokus pada upaya untuk melakukan efisiensi seiring makin melambungnya biaya produksi, belanja pegawai hingga ongkos energi. Sehingga mau tak mau akan menomorduakan persoalan pembuangan limbahnya mengingat pengolahan limbah memerlukan biaya tinggi. Sementara disisi lain negara gagal dalam melakukan penegakan hukum lingkungan.

Di tengah sistem yang manipulatif, maka tersedia berbagai pilihan untuk mengurangi jumlah limbah industri yang dihasilkan, yaitu dengan melakukan moratorium tambang terutama terhadap tambang besar, melakukan peninjauan ulang terhadap kontrak karya bahkan sampai pada tahap menghentikan pendirian industri ekstratif yang mengeruk SDA dan menghasilkan limbah yang besar dengan manfaat yang tidak seberapa bagi rakyat.

Sisi lemah dalam pelaksanaan peraturan perundangan lingkungan hidup yang menonjol adalah penegakan hukum, oleh sebab itu dalam bagian ini akan dikemukakan hal yang terkait dengan penegakan hukum lingkungan. Dengan pesatnya pembangunan nasional yang dilaksanakan yang tujuannya meningkatkan kesejahteraan masyarakat, ada beberapa sisi lemah, yang menonjol antara lain adalah tidak diimbangi ketaatan aturan oleh pelaku pembangunan atau sering mengabaikan landasan aturan yang mestinya sebagai pegangan untuk dipedomani dalam melaksanakan dan mengelola usaha dan atau kegiatannya, khususnya menyangkut bidang sosial dan lingkungan hidup, sehingga menimbulkan permasalahan lingkungan.

Oleh karena itu, sesuai dengan rencana Tindak Pembangunan Berkelanjutan dalam Perlindungan dan Pengelolaan Lingkungan Hidup dilakukan meningkatkan kualitas lingkungan melalui upaya pengembangan sistem hukum, instrumen hukum, penaatan dan penegakan hukum termasuk instrumen alternatif, serta upaya rehabilitasi lingkungan.

Pengelolaan lingkungan hidup adalah upaya terpadu untuk melestarikan fungsi lingkungan hidup yang meliputi kebijakan penataan, pemanfaatan, pengembangan, pemeliharaan, pemulihan, pengawasan dan pengendalian lingkungan hidup, sedangkan yang dimaksud lingkungan hidup adalah kesatuan ruang dengan semua benda, daya, keadaan dan makhluk hidup termasuk manusia dan perilakunya yang mempengaruhi kelangsungan perikehidupan dan kesejahteraan manusia serta makhluk hidup lain.

Kondisi lingkungan hidup dari waktu ke waktu ada kecenderungan terjadi penurunan kualitasnya, penyebab utamanya yaitu karena pada tingkat pengambilan keputusan, kepentingan pelestarian sering diabaikan sehingga menimbulkan adanya pencemaran dan kerusakan lingkungan. Dengan terjadinya pencemaran dan kerusakan lingkungan ternyata juga menimbulkan konflik sosial maupun konflik lingkungan. Dengan berbagai permasalahan tersebut diperlukan perangkat hukum perlindungan terhadap lingkungan hidup, secara umum telah diatur dengan Undang-undang No.4 Tahun 1982 (Sudarmadji, 2008).

Mengingat kompleksnya pengelolaan lingkungan hidup dan permasalahan yang bersifat lintas sektor dan wilayah, maka dalam pelaksanaan pembangunan diperlukan perencanaan dan pelaksanaan pengelolaan lingkungan hidup yang sejalan dengan prinsip pembangunan berkelanjutan yaitu pembangunan ekonomi, sosial budaya, lingkungan hidup yang berimbang sebagai pilar-pilar yang saling tergantung dan saling memperkuat satu sama lain. Di dalam pelaksanaannya melibatkan berbagai pihak, serta ketegasan dalam penaatan hukum lingkungan.
Diharapkan dengan adanya partisipasi barbagai pihak dan pengawasan serta penaatan hukum yang betul-betul dapat ditegakkan, dapat dijadikan acuan bersama untuk mengelola lingkungan hidup dengan cara yang bijaksana sehingga tujuan pembangunan berkelanjutan betul-betul dapat diimplementasikan di lapangan dan tidak berhenti pada slogan semata. Namun demikian fakta di lapangan seringkali bertentangan dengan apa yang diharapkan. Hal ini terbukti dengan menurunnya kualitas lingkungan hidup dari waktu ke waktu, ditunjukkan beberapa fakta di lapangan yang dapat diamati (Sudarmadji, 2008).

Beberapa masalah diantaranya terbentur oleh pendanaan yang masih sangat kurang untuk bidang lingkungan hidup. Program dan kegiatan mesti didukung dengan dana yang memadai apabila mengharapkan keberhasilan dengan baik. Walaupun semua orang mengakui bahwa lingkungan hidup merupakan bidang yang penting dan sangat diperlukan, namun pada kenyataannya anggaran  masih terlalu rendah yang dialokasikan untuk program pengelolaan lingkungan hidup, diperparah lagi tidak adanya dana dari APBN yang dialokasikan langsung ke untuk pengelolaan lingkungan hidup.

Kendala lainnya yaitu masalah keterbatasan sumberdaya manusia. Harus diakui bahwa didalam pengelolaan lingkungan hidup selain dana yang memadai juga harus didukung oleh sumberdaya yang mumpuni. Sumberdaya manusia seringkali masih belum mendukung. Personil yang seharusnya bertugas melaksanakan pengelolaan lingkungan hidup (termasuk aparat pemda) banyak yang belum memahami secara baik tentang arti pentingnya lingkungan hidup.

Masalah selanjutnya adalah eksploitasi sumberdaya alam masih terlalu mengedepankan profit dari sisi ekonomi. Sumberdaya alam seharusnya digunakan untuk pembangunan untuk mencapai kesejahteraan masyarakat. Walaupun kenyataannya tidak demikian; eksploitasi bahan tambang, logging hanya menguntungkan sebagian masyarakat, aspek lingkungan hidup yang seharusnya, kenyataannya banyak diabaikan. Fakta menunjukkan bahwa tidak terjadi keseimbangan antara ekonomi dan lingkungan hidup. Masalah lingkungan hidup masih belum mendapatkan porsi yang semestinya.

Lalu masalah selanjutnya adalah lemahnya implementasi paraturan perundangan. Peraturan perundangan yang berkaitan dengan lingkungan hidup, cukup banyak, tetapi dalam implementasinya masih lemah. Ada beberapa pihak yang justru tidak melaksanakan peraturan perundangan dengan baik, bahkan mencari kelemahan dari peraturan perundangan tersebut untuk dimanfaatkan guna mencapai tujuannya.

Selain itu juga lemahnya penegakan hukum lingkungan khususnya dalam pengawasan. Berkaitan dengan implementasi peraturan perundangan adalah sisi pengawasan pelaksanaan peraturan perundangan. Banyak pelanggaran yang dilakukan (pencemaran lingkungan, perusakan lingkungan), namun sangat lemah didalam pemberian sanksi hukum.

Masalah selanjutnya adalah pemahaman masyarakat tentang lingkungan hidup. Pemahaman dan kesadaran akan pentingnya lingkungan hidup sebagian masyarakat masih lemah dan hal ini, perlu ditingkatkan. Tidak hanya masyarakat golongan bawah, tetapi dapat juga masyarakat golongan menegah ke atas, bahkan yang berpendidikan tinggi pun masih kurang kesadarannya tentang lingkungan hidup.

Terakhir yaitu penerapan teknologi industri yang tidak ramah lingkungan. Penerapan teknologi tidak ramah lingkungan dapat terjadi untuk mengharapkan hasil yang instant, cepat dapat dinikmati. Mungkin dari sisi ekonomi menguntungkan tetapi mengabaikan dampak lingkungan yang ditimbulkan. Penggunaan pupuk, pestisida, yang tidak tepat dapat menyebabkan pencemaran lingkungan.

Begitu banyaknya masalah yang terkait dengan lingkungan hidup yang berkaitan dengan pembangunan industri. Masalah tersebut dapat timbul akibat proses pembangunan yang kurang memperhatikan aspek lingkungan hidup.

Dengan cara seperti ini maka terjadi kemerosotan kualitas lingkungan di mana-mana, yang diikuti dengan timbulnya bencana alam. Terdapat banyak hal yang menyebabkan aspek lingkungan hidup menjadi kurang diperhatikan dalam proses pembangunan, yang bervariasi dari daerah satu dengan daerah yang lain, dari hal-hal yang bersifat lokal seperti ketersediaan SDM sampai kepada hal-hal yang berskala lebih luas seperti penerapan teknologi yang tidak ramah lingkungan.
Peraturan perundangan yang berkaitan dengan pengelolaan lingkungan hidup sudah cukup memadai, namun demikian di dalam pelaksanaanya, termasuk dalam pengawasan, pelaksanaannya perlu mendapatkan perhatian yang sungguh-sungguh. Hal ini sangat terkait dengan niat baik pemerintah termasuk pemerintah daerah, masyarakat dan pihak-pihak yang berkepentingan untuk mengelola lingkungan hidup dengan sebaik-baiknya agar prinsip pembangunan berkelanjutan berwawasan lingkungan dapat terselenggara dengan baik. Oleh karena pembangunan pada dasarnya untuk kesejahteraan masyarakat, maka aspirasi dari masyarakat perlu didengar dan program-program kegiatan pembangunan betul-betul yang menyentuh kepentingan masyarakat.

Evaluasai Kuliah

Kuliah kimia & masyarakat yang terakhir ini adalah kuliah yang paling “hoki”. Selain mendapatkan banyak sekali pelajaran dari pengalaman Pak Gilbert  Sinamo, Pak Jatmiko dan Pak Suryadi, saya juga mendapatkan oleh-oleh beberapa bungkus kopi kesukaan saya yaitu Nescafe. Setidaknya saya bisa mereduksi pengeluaran selama seminggu untuk membeli kopi. Walaupun Bu Mega pernah berkata bahwa level mahasiswa honours itu tidak sepantasnya memikirkan masalah “dangdut” yaitu masalah yang berhubungan dengan dada sampai perut. Dalam hal ini saya mengerti maksud beliau yaitu supaya jangan sampai kita terus memikirkan masalah konsumsi. Tapi menurut saya sebagai orang Indonesia memang wajar masih memikirkan “dangdut”, toh hal tersebut tidak bertentangan dengan teori Maslow yang menempatkan kebutuhan ini pada level yang paling dasar dalam piramida kebutuhan manusia. Selama saya tinggal di Indonesia tidak ada salahnya berpikir dengan cara Indonesia, asal jangan sering-sering saja. Dengan begitu nilai budaya bangsa tetap melekat dalam diri kita. Terimakasih Pak Gilbert oleh-oleh Nescafe-nya.

Daftar Bacaan

Prigi Arisandi, 2004, Atur Limbah Industri dulu, Baru Domestik,

Lembaga Kajian Ekologi dan Konservasi Lahan Basah

http://id.wikipedia.org/wiki/Limbah

I Wayan “Gendo” Suardana, 2008, Limbah Industri Dan Limpahan Air Mata Manusia

(http://gendovara.blogdetik.com/2008/09/20/limbah-industri-dan-limpahan-air-mata-manusia/) tanggal akses 12 April 2008

Wahyu Hidayat, 2008, Teknologi Pengolahan Air Limbah

(http://majarimagazine.com/2008/01/teknologi-pengolahan-air-limbah/) tanggal akses 12 April 2008

Sudarmadji, 2008, Pembangunan Berkelanjutan, Lingkungan Hidup Dan Otonomi Daerah

(http://geo.ugm.ac.id/archives/125) tanggal akses 12 April 2008

Mencari Kandidat Energi Alternatif Pengganti Minyak Bumi di Indonesia

Tak terasa kuliah kimia dan masyarakat sudah memasuki minggu yang ke lima. Berarti hanya satu pertemuan lagi  saya bertemu dengan orang-orang penting di luar sana. Memasuki minggu kelima kedewasaan saya bertambah dalam mengerjakan tugas kimia dan masyarakat. Tugas kuliah kimia dan masyarakat cukup sederhana yaitu membuat esai sebanyak sepuluh halaman, spasi tunggal, jenis huruf Trebucht MS, dan ukuran huruf 11. Walaupun demikian kuliah ini memberikan ilmu yang sangat dahsyat bagi saya.

Kuliah ini sempat membuat entropi kehidupan saya meningkat, sangat menghabiskan waktu, penuh kesibukan apalagi setiap malam Jumat setidaknya segelas kopi pahit Nescafe dan sebungkus biskuit gurih harus tersedia di depan meja komputer saya. Setiap malam Jumat saya harus begadang ataupun tidak tidur sama sekali demi menghasilkan 10 lembar resume kuliah. Buat saya itu adalah sebuah keuntungan dan bukan kerugian apalagi saya belum terbiasa belajar menulis dengan baik.

Tulisan saya dapat dibedakan dari tulisan yang lainnnya yaitu tidak dapat dibedakan mana subjek,predikat dan objeknya. Tetapi hal tersebut saya rasa wajar saja, karena merupakan proses belajar. Sama dengan kuliah kimia dan masyarakat yaitu berguru kepada orang-orang yang sudah berpengalaman dan ahli dalam bidangnya. Saya sangat beruntung sekali.

Pada hari Jumat tanggal 27 Maret 2009 kuliah kimia dan masyarakat diisi oleh seorang tamu yang sangat istimewa. Saya tidak percaya bahwa kuliah pada hari itu akan disi oleh seorang pejabat penting. Pada hari itu kuliah diisi oleh Dr.-Ing. Evita H. Legowo Direktur Jenderal Minyak dan Gas Bumi, Departemen Energi dan Sumber Daya Mineral (DESDM).

Dr.-Ing. Evita H. Legowo lahir di Sragen, pada tanggal 3 November 1951, lama bekerja di bidang penelitian dan pengembangan teknologi minyak dan gas bumi. Untuk energi alternatif mempunyai pengalaman di bidang penelitian bahan bakar nabati, baik itu bioetanol ataupun biodiesel sejak tahun 1991. Kepala Pusat Penelitian pertama di bidang energi alternatif DESDM. Lulusan pertama angkatannya (1970) dari Departemen Kimia ITB pada Februari 1974; memperoleh gelar Doktor.-Ing. Kimia Minyak Bumi dari Technische, Universitaet Clausthal Jerman pada Februari 1991. Sekarang beliau menjabat Direktur Jenderal Minyak Dan Gas Bumi, Departemen Energi dan Sumber Daya Mineral (DESDM).

Dalam kuliahnya beliau mengambil tema tentang kebijakan energi nasional dan kebijakan sub sektor minyak dan gas bumi. Beliau menerangkan potensi minyak dan gas bumi di Indonesia sebagai penyokong ketahanan energi. Beliau juga menerangkan tentang potensi berbagai energi alternatif yang bisa dikembangkan sekaligus pengganti minyak bumi. Terakhir beliau menerangkan tentang kebijakan yang diambil pemerintah terhadap produksi minyak dan gas bumi menuju kesejahteraan rakyat.

Dalam resume ini saya akan membahas mengenai bagaimana memanfaatkan potensi kekayaan bangsa Indonesia yang ditujukan untuk mencari energi alternatif selain bahan bakar minyak dan gas. Menurut saya akan menjadi masalah di kemudian hari apabila pasokan energi tidak terpenuhi, krisis energi akan mendorong ke jurang kehancuran suatu bangsa.

Setelah semua potensi energi yang kita miliki dipaparkan dengan segala kelebihan dan kekurangannya maka selanjutnya saya akan menjelaskan bagaimana pelaksanaannya. Hal tersebut berkaitan sekali dengan peran serta pemerintah  sebagai pengambil kebijakan dan masyarakat sebagai objek kebijakan pemerintah.

Pembahasan yang pertama saya akan menerangkan tentang pentingnya energi dalam kehidupan kita. Menurut saya energi sudah termasuk kebutuhan primer, artinya kebutuhan ini sangat penting sekali bagi keberlangsungan hidup. Untuk sekarang ini energi bisa disejajarkan dengan kebutuhan akan air dan makanan. Bisa dibayangkan bagaimana pentingnya makanan dan air bagi keberlangsungan hidup, kebutuhan energi pun  mempunyai  posisi seperti itu.

Dalam kuliahnya Bu Evita menjelasklan tentang pentingya ketahanan energi  sebagai salah satu aspek yang berperan dalam menjaga ketahanan nasional. Ketahanan  nasional akan  tercapai apabila semua faktor-faktor yang mempengaruhinya dapat terpenuhi. Faktor-faktor yang mempengaruhi ketahanan nasional adalah ketahanan politik, ketahanan ekonomi, ketahanan sosial dan ketahanan budaya. Dalam hal ini energi sangat mempengaruhi kempat faktor penentu tersebut.

Kita dapat mengambil contoh dari kebijakan pemerintah yang menaikan harga minyak beberapa bulan yang lalu. Pemerintah terpaksa menaikan harga minyak pada waktu itu karena harga minyak dunia  melambung tinggi. Kebijakan pemerintah dengan menaikan harga minyak pada waktu itu bertujuan untuk menyelamatkan devisa negara dan sekaligus menjaga ketahanan ekonomi.

Tapi efek yang ditimbulkannya pun  tidak kalah hebat. Hampir saja pemerintahan Presiden Susilo Bambang Yudhoyono jatuh pada waktu itu  yang diakibatkan oleh unjuk rasa anti kenaikan BBM yang dilakukan oleh masyarakat dan mahasiswa. Ketahanan politik menjadi goyah  pada waktu itu hanya karena kenaikan harga BBM. Akibat yang tak kalah hebatnya lagi adalah ketahanan sosial pun menjadi goyah. Akibat kenaikan harga BBM itu maka angka kemiskinan  meningkat, banyak usaha kecil yang gulung tikar dan  para pekerja di-PHK untuk mengurangi beban perusahaan.

Dari contoh diatas dapat diambil kesimpulan bahwa ketahanan energi itu sangat penting bagi kehidupan kita dan menjadi salah satu aspek yang menjaga stabilitas nasional. Tanpa ketahanan energi suatu negara akan kacau karena pilar pentingnya hilang. Oleh karena itu, pemerintah harus sadar tentang pentingnya energi untuk menjaga stabilitas nasional.

Sekarang dan beberapa tahun yang akan datang bangsa Indonesia masih tergantung pada bahan bakar minyak dan gas.  Bahan bakar minyak dan gas bumi masih menjadi primadona untuk memenuhi sebagian besar kebutuhan energi di Indonesia. Energi yang berasal dari minyak bumi ini digunakan untuk pembangkit tenaga listrik, menjalankan industri dan memenuhi kebutuhan rumah tangga.

Ketergantungan terlalu banyak terhadap bahan bakar fosil akan menjadi ancaman suatu saat nanti apabila kita tidak segera menemukan energi alternatif pengganti bahan bakar fosil. Sebagaimana kita tahu bahwa bahan bakar fosil ini merupakan energi yang tidak terbaharukan, artinya kalau suatu saat nanti bahan bakar ini habis maka diperlukan berjuta-juta tahun untuk diproduksi kembali.

Oleh karena itu melihat betapa rentannya kebutuhan akan energi maka mulai sekarang kita harus mencari energi kandidat yang terbaik untuk mengganti bahan bakar fosil. Energi pengganti yang bisa dimanfaatkan atara lain energi nuklir, biodiesel dan biomassa. Kenapa hal tersebut dipilih oleh penulis, alasan utamanya adalah karena kita mempunyai kekayaan alam yang melimpah dan cocok di kembangkan di Indonesia.

Dalam hukum kekekalan energi yang pertama dikatakan bahwa energi adalah kekal, artinya energi tidak dapat diciptakan dan tidak dapat dimusnahkan  tetapi dapat diubah dari bentuk yang satu ke bentuk yang lain. Dalam hal ini penulis mengambil kesimpulan bahwa semua benda itu mempunyai potensi energi. Tetapi bagaimana kita mengubah potensi menjadi bentuk energi dari suatu benda maka hal tersebut merupakan pekerjaan rumah yang harus segera diselesaikan.

Misalkan saja kita ambil suatu contoh sederhana. Pada suatu saat tertentu kita terdesak memerlukan energi untuk memasak sedangkan bahan bakar minyak dan gas sudah habis. Keadaan kita pada waktu itu sedang terdesak dan harus secepatnya mendapatkan energi. Bagaimana sikap kita seharusnya?. Karena keadaan kita terdesak pada waktu itu maka kita harus memanfaatkan potensi benda-benda yang ada di sekeliling kita untuk dijadikan sebagai sumber energi.

Misalkan saja kandidat yang terbaik setelah kita mencari bahan-bahan tersebut kita menemukan sebuah  kursi yang terbuat dari kayu di sekitar dapur kita.  Dengan mengetahui potensi yang ada pada kayu tersebut maka kita bisa memanfaatkan kursi tersebut sebagai kayu bakar. Menurut saya strategi untuk mencari energi alternatif, contoh ekstrimnya seperti itu.  Jadi strategi dalam mencari energi alternatif menurut saya adalah bagaimana kita memanfaatkan semua potensi dari sumber daya alam yang ada untuk diubah menjadi bentuk energi yang efektif dan efisien.

Potensi sumber daya alam yang digunakan sebagai energi alternatif  pengganti minyak bumi di Indonesia cukup banyak. Diantara kandidat yang bisa digunakan sebagai energi alternatif dalam resume ini saya akan menyarankan penggunaan energi nuklir, biodisel dan biomassa. Saya akan membahas satu persatu dari energi alaternatif yang saya usulkan kemudian dipilih mana yang menjadi kandidat terbaik. Saya menggunakan beberapa sumber baik dari internet ataupun buku dalam menerangkan tentang potensi yang berasal dari energi alternatif tersebut.

Untuk kandidat yang pertama saya akan membahas mengenai potensi dari nuklir sebagai energi pengganti minyak bumi.

Potensi Energi Alternatif

a. Energi Nuklir

Energi nuklir  menurut saya adalah energi yang paling bersih. Selain itu energi ini memberikan hasil yang efektif dan efisien. Dari sedikit uranium saja kita dapat mendapatkan energi yang sangat melimpah melalui reaksi fusi dan atau reaksi fisi. Dalam reaksi nuklir dikenal dua reaksi  yaitu reaksi fusi nuklir dan reaksi fisi nuklir.

Reaksi fusi nuklir adalah reaksi peleburan dua atau lebih inti atom menjadi atom baru dan menghasilkan energi. Reaksi fisi nuklir adalah reaksi pembelahan inti atom akibat tubrukan inti atom lainnya, dan menghasilkan energi dan atom baru yang bermassa lebih kecil serta radiasi elektromagnetik. Reaksi fusi juga menghasilkan radiasi sinar alfa, beta dan gamma yang sangat berbahaya bagi manusia.

Contoh reaksi fusi nuklir adalah reaksi yang terjadi di hampir semua inti bintang di alam semesta. Senjata bom hidrogen juga memanfaatkan prinsip reaksi fusi tak terkendali. Contoh reaksi fisi adalah ledakan senjata nuklir dan pembangkit listrik tenaga nuklir.

Unsur yang sering digunakan dalam reaksi fisi nuklir adalah Plutonium dan Uranium (terutama Plutonium-239, Uranium-235), sedangkan dalam reaksi fusi nuklir adalah Litium dan Hidrogen (terutama Litium-6, Deuterium, Tritium) (http://id.wikipedia.org/wiki/Reaksi_nuklir).

Tenaga listrik dihasilkan melalui proses konversi energi dari energi tertentu menjadi energi listrik  yang  dilakukan  oleh  suatu  pembangkit  tenaga  listrik.  Proses  ini  biasanya melalui beberapa tahap konversi energi. Proses akhir konversi tersebut umumnya berupa konversi energi mekanik menjadi energi listrik berdasarkan pada hukum Faraday. Hukum Faraday menyatakan  bahwa  gaya  gerak  listrik  (GGL)  dapat terjadi  dari  proses  perubahan  fluks medan magnet terhadap waktu. Perubahan fluks medan magnet ini dapat diterapkan pada sebuah  rotor  dalam  generator  yang  digerakkan  oleh  sebuah  turbin  yang  berputar   oleh aliran  gas,  air  ataupun  uap.  Aliran  tersebut berasal  dari  energi  yang  dihasilkan  oleh batubara, nuklir, gas, panas bumi, biogas, matahari, dan sumber lain.

Pembangkit listrik tenaga nuklir (PLTN) memerlukan bahan  bakar  sebuah  reaktor  nuklir  berupa  uranium.  Uranium  merupakan salah satu hasil

Gambar: reaksi fisi nuklir

Sumber: (http://id.wikipedia.org/wiki/Reaksi_nuklir).

tambang yang terdapat dibumi. Uranium-238 (U-238) mempunyai waktu paruh yang sangat lama (4,5 milyar tahun) dengan komposisi 99 persen dari total uranium yang ada di bumi. Komposisi  lainnya, U-235 mempunyai  sekitar 0,7 persen dan U-234 jauh  lebih  rendah  yang  dibentuk  melalui  proses  peluruhan  U-238  (U-238  melalui beberapa  tahap peluruhan alfa dan beta untuk membentuk  isotop yang  lebih stabil dan U-234 adalah salah satu hasil dari mata rantai dari peluruhan ini) (Amin Mutohar, 2008).

Gambar: proses pengubahan energi nuklir menjadi energi listrik (PLTN) (Amin Mutohar, 2008).

Dalam sebuah reaktor nuklir, butiran uranium yang sudah diperkaya disusun dalam sebuah balok dan dikumpulkan ke dalam bundelan (reaktor). Bundelan tersebut direndam dalam air pada sebuah bejana tekan. Air tersebut digunakan sebagai sebuah pendingin. Bundelan uranium yang digunakan pada reaktor nuklir berada dalam keadaan superkritis. Hal ini dapat menyebabkan uranium menjadi panas dan meleleh dengan mudah. Untuk mencegahnya, sebuah balok kontrol (control rods) dibuat dengan bahan yang menyerap neutron. Balok kontrol dimasukkan kedalam bundelan uranium dengan menggunakan sebuah mekanisme yang dapat mengangkat atau menurunkan balok kontrol tersebut. Pengangkatan dan penurunan balok kontrol menerima perintah seorang operator untuk mengatur jumlah reaksi nuklir. Ketika seorang operator menginginkan inti uranium untuk menghasilkan panas yang lebih, balok kontrol dinaikkan dari bundelan uranium. Sebaliknya, jika ingin panas berkurang maka balok kontrol harus diturunkan. Balok kontrol dapat diturunkan hingga komplit untuk menghentikan reaktor nuklir jika terjadi kasus kecelakaan atau penggantian bahan bakar (Amin Mutohar, 2008).

Bundelan uranium digunakan sebagai sumber energi panas yang sangat tinggi. Panas ini dapat mengubah air menjadi uap air. Uap air ini digunakan untuk menggerakkan sebuah turbin uap yang memutar rotor pada generator. Berdasarkan hukum Faraday putaran rotor dikonversi menjadi tenaga listrik. Dalam beberapa reaktor, uap air akan melalui tahap kedua sebagai pengubah panas medium untuk mengubah air menjadi uap air yang menggerakkan turbin. Keuntungan dari desain ini adalah air atau uap air yang tercemar bahan radioaktif tidak akan mengenai turbin. Dalam reaktor nuklir yang sama, fluida pendingin dalam kontak dengan inti reaktor dapat berupa gas (karbon dioksida) atau logam cair (sodium, potasium). Tipe reaktor ini menerima inti uranium untuk beroperasi pada suhu yang lebih tinggi (Amin Mutohar, 2008).

       
b. Biodiesel
Energi alternatif lainnya yang bisa digunakan sebagai kandidat minyak bumi adalah biodiesel. Kenaikan harga minyak dunia beberapa waktu lalu, sungguh sangat menyulitkan bagi masyarakat Indonesia.  Kenaikan itu menyebabkan harga barang barang naik karena biaya produksi yang mendapat suplai energi dari bahan bakar minyak (BBM) ikut terkena dampak  kenaikan. Beberapa dekade ke depan dapat diramalkan bagaimana situasai masyarakat Indonesia dan dunia apabila cadangan minyak habis dan energi alternatif yang diusulkan belum bisa menggantikan peranan penting dari minyak bumi. Resesi akan melanda bangsa Indonesia dan dunia .

Kalau kita dapat mensyukuri kekayan sumber daya alam, sebenarnya kita sebagai bangsa Indonesia tidak perlu khawatir terhadap ancaman krisis energi. Salah satu energi alternatif yang bisa diandalkan adalah bahan bakar alami (biofuel). Sumber biofuel ini berasal dari tanaman pertanian, limbah industri dan lain-lain.

Melihat kesuburan tanah, iklim dan mata pencahariaan masyarakat Indonesia adalah petani maka biofuel yang cocok dikembangkan  di Indonesia adalah biodiesel. Biodiesel adalah  bahan bakar mesin diesel yang berasal dari sumber terbaharukan (renewable). Meskipun banyak perhatian karena terbaharukan, biodiesel ini bisa digunakan murni atau dicampur dengan bahan bakar fosil  tanpa melakukan modifikasi pada mesin diesel sehingga dapat mengurangi polusi yang dihasilkan.

Definisi biodiesel perspektif kimia adalah monoalkil ester asam lemak yang diperoleh dari suatu reaksi transesterifikasi antara minyak tumbuhan, lemak hewan atau minyak bekas yang memiliki trigliserida dengan metanol atau etanol  dengan bantuan katalis (NaOH, KOH). Produk utama dari reaksi ini adalah monoalkil ester asam lemak (biodiesel) dan produk sampingnya adalah gliserol.

Gambar: sebuah bus yang menggunakan bahan bakar biodiesel (kiri) (http://en.wikipedia.org/wiki/File:Soybus.jpg) dan model ball and stick dari metil linoleat yang diperoleh dari proses transesterifikasi kacang kedelai (kanan) (http://en.wikipedia.org/wiki/File:Methyl_Linoleate.png)

Sifat bahan bakar biodiesel ditentukan oleh jumlah asam lemak yang digunakan untuk proses esterifikasi. Asam lemak ini ditentukan oleh dua nomor yaitu nomor pertama menentukan jumlah karbon yang ada pada asam lemak dan nomor kedua mentukan jumlah ikatan rangkap yang ada padam asam lemak. Misalkan 18:1 adalah asam oleat yang mempunyai 18 atom karbon dan memiliki 1 ikatan rangkap.

Biodiesel lebih baik dibandingkan minyak bumi karena pembakarannya bersih, energinya efisien, tidak beracun, dapat diuraikain secara biologis, mungurangi pemanasan global dan cocok untuk lingkungan yang sensitif. Menggunakan biodiesel sebagai bahan bakar dapat meningkatkan cadangan energi, melindungi kesehatan masyarakat dan lingkungan. Biodiesel dapat mengurangi efek rumah kaca karena karbon dioksida yang dihasilkan dari pembakaran biodiesel berasal dari tanaman pertanian yang digunakan lagi pada proses fotosintesis sehingga terbaharui.

Dibandingkan minyak bumi, biodiesel mengurangi emisi hidrokarbon yang tidak terbakar, karbon monoksiada, sulfat, polisiklik aromatik hidrokarbon, nitrat polisiklik hidrokarbon dan partikulat.

Gambar proses transesterifikasi biodiesel

Sumber: www. http://en.wikipedia.org/wiki/

B100 (biodiesel murni) mengurangi emisi karbon dioksiada lebih dari 75% dibandingkan minyak diesel yang berasal dari minyak bumi. B20 (biodiesel campuran) mengurangi karbon dioksida sebanyak 15 %.

Biodiesel dapat dibuat menggunakan teknologi esterifikasi. Minyak dan lemak disaring sebagai praproses untuk menghilangkan air dan pengotor.  Jika terdapat asam lemak bebas, asam lemak itu dapat diubah menjadi biodiesel mengguanakan teknologi khusus. Minyak dan lemak kemudian dicampur dengan alkohol (biasanya metanol) dan katalis (NaOH). Molekul minyak (trigliserida) kemudian dipecah untuk dibentuk menjadi metil ester asam lemak (biodiesel) dan gliserol, yang kemudian dipisahkan satu sama lain dan dimurnikan. Skema pembuatan biodiesel dapat dilihat pada gambar diatas.

Biodiesel dapat dibuat dari bahan-bahan hasil pertanian yang menghasilkan minyak sayur seperti kedelai, kacang tanah, jagung, kelapa, dan minyak biji jarak. Selain itu lemak hewan dan minyak bekas hasil penggorengan juga bisa digunakan sebagai bahan baku asam lemak. Betapa mudahnya memperoleh bahan baku biodiesel sehingga ada optimisme dari penulis sebagai seorang kimiawan bahwa biodiesel adalah salah satu kandidat energi alternatif pengganti minyak bumi yang cocok dikembangkan di Indonesia.

c. Biomassa

Masalah lingkungan sebenarnya memiliki solusi yang berasal dari lingkungan juga. Problem gas rumah kaca dan krisis energi misalnya, bisa dijawab dengan biomassa yang asal mulanya dari alam. Gas rumah kaca yang disebabkan oleh bahan bakar fosil, seperti karbon dioksida ketika dilepaskan di atmosfer, keberadaannya akan menghalangi panas yang akan meninggalkan bumi sehingga akan meningkatkan temperatur bumi. Bila hal ini terjadi maka maka akan terjadi perubahan iklim yang akan mempengaruhi kualitas kehidupan di lingkungan kita. Selain disebabkan oleh CO2, gas berikut juga memiliki kontribusi dalam pemanasan global, metana (CH4) dan nitrogen dioksida (N2O). Pembakaran biomassa sebenarnya menghasilkan CO2 tetapi karbon dioksida yang di hasilkan akan distabilisasi dengan serap kembali oleh tumbuhan, sehingga tidak ada penimbuan karbon dioksida dalam atmosfer dan keberadaannya terus seimbang.

Tahun 1998 merupakan tahun dimana terjadi peningkatan terbesar temperatur. Peningkatan temperatur ini menyebabkan pencairan es di kutub sehingga volume lautan meningkat dan ketingian permukaan laut meningkat 10 sampai 25 cm. Bahkan diprediksikan tahun 2100 temperatur akan meningkat secara tajam hingga mencapai 6 0C. Dampak itulah yang memicu terjadinya bencana alam yang akan menurunkan kualitas hidup manusia (Nugroho Agung Pambudi, 2008).

Untuk mencegah berbagai macam dampak dari pemanasan global, dapat dilakukan dengan mengurangi atau menghentikan proses yang paling besar dalam memicu gas rumah kaca tersebut yaitu pembakaran bahan bakar fosil. Pembakaran bahan bakar berkaitan erat dengan pemenuhan sektor energi bagi peningkatan perekonomian suatu negara. Pengembangan biomassa sebagai sumber energi untuk substitusi bahan bakar bisa menjadi solusi untuk mengurangi beredarnya gas rumah kaca di atmosfer.

Dengan penggunaan biomassa sebagai sumber energi maka konsentrasi CO2 dalam atmosfer akan seimbang. Pada waktu yang sama manusia makin menyebabkan peningkatan rumah kaca dengan penebangan hutan secara luas (deforestrisasi) sehingga mengurangi kemampuannya untuk menyerap gas CO2.

Disamping itu hasil hutan yang diperoleh dibakar dan menghasilkan CO2 dan beberapa materi partikulat. Konferensi tentang perubahan iklim telah dilakukan di Kyoto, Jepang pada tahun 1997 (Nugroho Agung Pambudi, 2008).

Gambar: hutan sebagai sumber biomassa yang melimpah di Indonesia

Sumber: http://www.cus.net

Indonesia sebagai negara agraris yang beriklim tropis memiliki beberapa sumber energi terbarukan yang berpotensi besar antara lain : energi hidro dan mikrohidro, energi geotermal, energi biomassa, energi surya dan energi angin. Potensi biomassa yang besar di negara kita hingga mencapai 49.81 GW tidak sebanding dengan kapasitas terpasang sebesar 302.4 MW (Nugroho Agung Pambudi, 2008). Bila kita maksimalkan potensi yang ada dengan menambah jumlah kapasitas terpasang, maka akan membantu bahan bakar fosil yang selama ini menjadi tumpuan dari penggunaan energi. Hal ini akan membantu perekonomian yang selama ini menjadi boros akibat dari anggaran subsidi bahan bakar minyak yang jumlahnya melebihi anggaran sektor lainnya.

Energi biomassa menjadi penting bila dibandingkan dengan energi terbaharukan karena proses konversi menjadi energi listrik memiliki investasi yang lebih murah bila dibandingkan dengan jenis sumber energi terbaharukan lainnya. Hal inilah yang menjadi kelebihan biomassa dibandingkan dengan energi lainnya. Proses energi biomassa sendiri memanfaatkan energi matahari untuk merubah energi panas menjadi karbohidrat melalui proses fotosintesis yang selanjutnya diubah kembali menjadi energi panas.

Penggunaan biomassa untuk menghasilkan panas secara sederhana sebenarnya telah dilakukan oleh nenek moyang kita beberapa abad yang lalu. Penerapannya masih sangat sederhana, biomassa langsung dibakar dan menghasilkan panas. Di zaman modern sekarang ini panas hasil pembakaran akan dikonversi menjadi energi listrik melalui turbin dan generator. Panas hasil pembakaran biomassa akan menghasilkan uap dalam boiler. Uap akan ditransfer kedalam turbin sehingga akan menghasilkan putaran dan menggerakan generator. Putaran dari turbin dikonversi menjadi energi listrik melalui magnet-magnet dalam generator. Pembakaran langsung terhadap biomassa memiliki kelemahan, sehingga pada penerapan saat ini mulai menerapkan beberapa teknologi untuk meningkatkan manfaat biomassa sebagai bahan bakar. Beberapa penerapan teknologi konversi yaitu :

  • Densifikasi

Praktek yang mudah untuk meningkatkan manfaat biomassa adalah membentuk menjadi briket atau pellet. Briket atau pellet akan memudahkan dalam penanganan biomassa. Tujuannya adalah untuk meningkatkan densitas dan memudahkan penyimpanan dan pengangkutan. Secara umum densifikasi (pembentukan briket atau pellet) mempunyai beberapa keuntungan (Bhattacharya dkk., 1996) yaitu : menaikan nilai kalor per unit volume, mudah disimpan dan diangkut, mempunyai ukuran dan kualitas yang seragam.

  • Karbonisasi

Karbonisasi merupakan suatu proses untuk mengkonversi bahan orgranik menjadi arang . pada proses karbonisasi akan melepaskan zat yang mudah terbakar seperti CO, CH4, H2, formaldehid, metana dan asam asetat serta zat yang tidak terbakar seperti seperti CO2, H2O dan tar cair. Gas-gas yang dilepaskan pada proses ini mempunyai nilai kalor yang tinggi dan dapat digunakan untuk memenuhi kebutuhan kalor pada proses karbonisasi.

  • Pirolisis

Pirolisis atau bisa disebut termolisis adalah proses dekomposisi kimia dengan menggunakan pemanasan tanpa kehadiran oksigen. Proses ini sebenarnya bagian dari proses karbonisasi yaitu proses untuk memperoleh karbon atau arang, tetapi sebagian menyebut pada proses pirolisis merupakan high temperature carbonization (HTC), lebih dari 500 oC. Proses pirolisis menghasilkan produk berupa bahan bakar padat yaitu karbon, cairan berupa campuran tar dan beberapa zat lainnya. Produk lain adalah gas berupa karbon dioksida (CO2), metana (CH4) dan beberapa gas yang memiliki kandungan kecil.

  • Anaerobic digestion

Proses anaerobic igestion yaitu proses dengan melibatkan mikroorganisme tanpa kehadiran oksigen dalam suatu digester. Proses ini menghasilkan gas produk berupa metana (CH4) dan karbon dioksida (CO2) serta beberapa gas yang jumlahnya kecil, seperti H2, N2, dan H2S. Proses ini bisa diklasifikasikan menjadi dua macam yaitu anaerobic digestion kering dan basah. Perbedaan dari kedua proses anaerobik ini adalah kandungan biomassa dalam campuran air. pada anaerobik kering memiliki kandungan biomassa 25 – 30 % sedangkan untuk jenis basah memiliki kandungan biomassa kurang dari 15 % (Sing dan Misra, 2005).

  • Gasifikasi

Gasifikasi adalah suatu proses konversi untuk merubah material baik cair maupun pada menjadi bahan bakar cair dengan menggunakan temperatur tinggi. Proses gasifikasi menghasilkan produk bahan bakar cair yang bersih dan efisien daripada pembkaran secara langsung, yaitu hidrogen dan karbon monoksida. Gas hasil dapat di bakar secara langsung pada internal combustion engine atau reaktor pembakaran. Melalui proses Fische-Tropsch gas hasil gasifikasi dapat di ekstak menjadi metanol.

Kandidat Energi Alternatif Terbaik

Semua potensi yaitu energi nuklir, biodiesel dan biomassa tidak bernilai tanpa adanya dukungan dari pemerintah serta masyarakat luas. Peran serta masyarakat akan sangat membantu dalam pengimplemetasian pengembangan energi alternatif pengganti minyak bumi, sehingga pada akhirnya bangsa ini mampu keluar dari krisis energi dengan pasokan energi bahan bakar alternatif yang berkelanjutan.

Kalau saya disuruh untuk memilih dari ketiga energi yaitu energi nuklir, biomassa dan biodiesel sebagai pengganti minyak bumi maka saya sulit untuk menjawabnya. Hal tersebut dikarenakan ketiga energi tersebut tidak mewakili keseluruhan dari multifungsi minyak bumi.

Minyak bumi adalah bahan bakar universal menurut saya. Minyak bumi adalah bahan bakar yang mempunyai potensi energi yang sangat luwes, artinya energi minyak bumi mudah diubah bentuknya menjadi energi yang lain. Misalkan saja untuk menggerakan mobil diperlukan bensin sebagai bahan bakar. Kita tidak mungkin mengganti energi yang dihasilakan oleh minyak bumi dengan energi nuklir. Untuk saat ini saya tidak bisa membayangkan bagaimana bentuk mobil pribadi yang mempunyai bahan bakar nuklir, sepertinya kalau ada pun sangat tidak efisien sekali. Berbeda dengan pesawat ruang angkasa, roket, ataupun kapal laut yang membutuhkan energi yang sangat besar maka penggunaan energi nuklir sebagai energi alternatif sangat cocok.

Jadi menurut saya ketiga bentuk energi alaternatif tersebut jangan dipilih satu-satu mana yang terbaik. Semua energi alternatif yang saya usulkan adalah bentuk energi yang sesuai dengan bidang penggunaannya, artinya bentuk energi ini tidak dapat melakukan seluruh fungsi dari minyak bumi tetapi dapat mewakili cakupan bidang tertentu saja.

Misalkan saja untuk mengganti minyak bumi yang digunakan dalam skala rumahan dan industri kecil bisa digunakan energi alternatif biomassa. Energi biomassa ini dapat berupa briket, biogas ataupun bentuk yang lain sebagaimana yang saya uraikan pada pembahasan diatas. Jadi bentuk energi biomassa ini bisa disesuaikan dengan keperluan. Selain itu penggunaan energi biomassa dapat mengurangi pencemaran lingkungan yang disebabkan oleh bahan-bakar fosil. Karena bahan bakar ini dapat diperbaharui.

Contoh yang lainnya misalkan untuk mengganti minyak bumi sebagai bahan bakar kendaraan bermotor kita dapat menggunakan biodiesel. Biodiesel ini sangat baik sekali karena selain sumbernya bisa berasal dari alam, biodiesel ini juga dapat menurunkan angka pengangguran. Peran serta pemerintah, ilmuan dan juga teknokrat sangat vital dalam kemajuan suatu bangsa. Oleh karena itu perlu adanya harmonisasi antara pemerintah sebagai penentu kebijakan, ilmuan dan teknorat sebagai penggerak kebijakan dan  masyarakat sebagai pengikut kebijakan.

Apabila ketiga komponen itu berjalan maka roda perekonomian akan berjalan seimbang. Pengembangan biodiesel sebagai energi alternatif akan memberikan banyak lapangan pekerjaan pada berbagai lapisan masyarakat baik masyarakat kelas bawah maupun kelas atas. Masyarakat kelas bawah khususnya para petani dapat menyediakan bahan baku lewat hasil pertanian seperti kedelai, kelapa, kacang tanah, jagung  dan barang hasil pertanian lainnya.

Masyarakat menegah ke atas dapat berperan dalam proses pembuatan biodiesel dan menggerakan sektor industri. Bergeraknya masyarakat sesuai dengan perannya masing-masing akan menyebabkan roda perekonomian berjalan, mengurangi angka pengangguran dan kesenjangan antara kaya dan miskin. Bangsa Indonesia akan menjadi bangsa yang mandiri karena dapat mencukupi kebutuhan energi tanpa harus banyak bergantung negara lain.

Jadi kesimpulannya energi alternatif tersebut dapat digunakan sebagai pengganti minyak bumi apabila digunakan secara integratif sesuai dengan bidangnya.

Evaluasi Kuliah

Kuliah kimia dan masyarakat pada  tanggal 27 Maret 2009 sungguh sangat spesial bagi penulis karena bisa bertemu dengan pejabat penting seperti Dr Dr.-Ing. Evita H. Legowo Direktur Jenderal Minyak dan Gas Bumi, Departemen Energi dan Sumber Daya Mineral (DESDM).

Ilmu yang penulis dapat dari Bui Evita adalah nilai dari sebuah ketekunan, kerja keras, berjiwa besar dan juga berpikir positif. Itulah yang menjadi kunci Beliau dalam merintis karirnya.

Seseorang akan menjadi manusia besar diawali oleh pikirannya. Apabila pikiran manusia hanya berpikir kecil maka manusia tersebut tidak akan pernah menjadi orang-orang yang besar. Sebaliknya apabila manusia berpikir suatu hal yang besar maka manusia tersebut akan menjadi orang-orang yang besar.

Dalam menghadapi pembangunan yang berkelanjutan yang perlu diperhatikan adalah manusia yang berkualitas terutama dalam pemikiran daripada kuantitas manusia yang bekerja dalam pembangunan. Kualitas dari manusia dapat dilihat dari pola pikirnya. Dengan pemikiran yang besar dapat membuat manusia menjadi visioner. Manusia visioner merupakan manusia yang bisa melakukan pencapaian-pencapaian besar. Manusia-manusia visioner dapat menjadi golongan creative minority. Creative minority merupakan sekumpulan manusia yang minoritas yang dapat melakukan suatu perubahan besar.

Dalam menjalani hidup, tentu saja kita sebagai manusia selalu ada masalah dan tantangan yang diberikan Tuhan. Apa yang Tuhan berikan itu pastilah untuk menguji kita sebagai hamba apakah tetap berada dijalan-Nya atau tidak. Setiap orang punya masalah tapi yang membedakan orang yang satu dengan yang lain adalah bagaimana orang tersebut me-manage dan menyikapi masalah yang dihadapi.

Secara sadar ataupun tidak, kita sering mengeluh dan berpikir negatif terhadap keadaan atau situasi yang kita alami. Berpikiran negatif kepada sesama manusia saja tidak baik, apalagi kalau kita sampai berpikiran negatif kepada Sang Pencipta.

Keadaan kita tidak akan berubah dari satu kondisi ke kondisi lain, kecuali dengan usaha kita sendiri. Memang semuanya hanya akan terjadi dengan takdir Tuhan, tetapi dalam menjadikan segala sesuatu itu, Tuhan menggunakan sebab. Selama kita belum mengenal hukum perubahan ini dengan baik, maka segala upaya untuk mengatasi rasa cemas atau agar terbebas dari kesusahan, tidak berguna. Kita tidak akan mampu terbebas dari rasa cemas kecuali jika kita sendiri bersikeras untuk mengatasi hal ini.

Luruskan niat, perbanyak dan optimalkan ikhtiar. Hilangkan penyakit hati. Sering kali kita sendirilah yang membuat rasa cemas terjadi pada diri kita. Juga kita sendiri yang memilih terjadinya kesusahan dan kesedihan. Penyakit ini tentu bukan karena virus akan tetapi penyakit akibat adanya kerusakan pikiran kita dan akibat sedikitnya iman kita kepada Tuhan.

Cintailah orang lain seperti mencintai diri sendiri. Kalimat sederhana itu bermakna dalam karena merupakan hal yang dapat membawa kebahagiaan bagi jiwa manusia. Ketika kita mencintai saudara kita seperti kita mencintai diri sendiri, dada kita akan terasa lapang. Jiwa kita terasa tenang dan kita akan merasakan puncak kepuasan.

Kebahagiaan kita menjadi bertambah ketika kita menanggalkan titik-titik hitam. Titik-titik hitam ini bisa berupa rasa dengki, iri, benci, dendam, dan sebagainya. Jangan bersedih dengan masa lalu. Pikirkan dan  laksanakan masa kini. Persiapkan diri untuk masa depan.

Adanya perasaan sedih karena masa lalu, juga karena mengingat peristiwa masa lalu yang tidak mungkin kembali lagi merupakan suatu kelemahan yang akan menjadikan seseorang terus merasa terus terbelenggu dan hanya akan menjadikannya lemah dan tak berdaya. Hal-hal seperti itulah yang dapat saya dapat dari kuliah kimia dan masyarakat pada waktu itu.

Evaluasi  perkuliahan ini dari penulis sedikit saja karena menurut penulis palaksanaan kuliah kimia dan pada masyarakat  pada hari Jumat yang lalu sudah baik.  Gilang sudah melaksanakan dengan baik sebagai host person dan maupun sebagai seorang moderator.

Saya mendapat pelajaran yang sangat berharga dari perkuliahan  ini apalagi informasinya langsung didapat dari orang yang tepat. Dulu saya berpikir kenapa potensi minyak kita dikerjakan oleh perusahaan asing padahal kalau kita mengelolanya sendiri kita akan memperoleh untung yang sangat banyak dan tidak perlu mengimpor  minyak dari negara lain. Tapi dengan penjelasan  Bu Evita saya bisa memahami apa yang terjadi dengan keadaan di negeri kita, ternyata tidak gampang berkecimpung dengan dunia perminyakan karena mempunyai resiko yang sangat besar.

Jadi sekarang saya tidak berpikiran buruk lagi dengan perusahaan-perusahan minyak  negara kita, saya bisa memahami apa yang terjadi. Tetapi suatu saat nanti kita harus mengambil alih dominasi perusahaan asing, kita harus berdiri sendiri dan itu adalah tugas saya, saya bisa melakukannya.

Daftar Pustaka

Singh, R.K and Misra, 2005, Biofuels from Biomass, Department of Chemical Engineering National Institue of Technology, Rourkela

Daugherty E.C, 2001, Biomass Energy Systems Efficiency:Analyzed through a Life Cycle Assessment, Lund Univesity.

Vest, H., 2003, Small Scale Briquetting and Carbonisation of Organic Residues for Fuel, Infogate, Eschborn, Germany

Amin Mutohar, 2008, Nuklir Sebagai Sumber Energi listrik (http://mutohar.wordpress.com/2008/01/19/nuklir-sebagai-sumber-energi-listrik)/

http://id.wikipedia.org/wiki/Reaksi_nuklir (diakses tanggal 29 Maret 2009)

http://en.wikipedia.org/wiki/Biodiesel (diakses tanggal 29 Maret 2009)

http://www.cus.net/conservatories/conservatory-overview.html (diakses tanggal 29 Maret 2009)

http://netsains.com/category/artikel/  (diakses tanggal 29 Maret 2009)

Pembuatan Alat Diagnosis Virus Dengue Murah dengan Menggunakan Epitop Protein Dengue yang Spesifik Terhadap Immunoglobulin G (IgG) Berbasiskan Imunokromatografi dan Imunofluresensi

Tak terasa kuliah kimia dan  masyarakat sudah memasuki minggu ke empat. Waktu terasa sangat cepat sekali berlalu eskipun dalam perjalanannya berbagai kerikil tajam silih berganti menghalangi penulis untuk tetap melangkah ke depan. Berbagai hambatan yang silih berganti sempat membuat penulis shock dengan apa yang terjadi pada semester ini tetapi penulis yakin bahwa hal itu akan menjadi masa lalu pada akhirnya. Tugas-tugas perkuliahan yang silih bergantI, UTS, PR dan tugas resume kulih kimia dan masyarakat cukup menyita perhatian penulis. Tetapi penulis yakin ini pun akan menjadi massa lalu pada akhirnya.

Semoga saja semua apa yang telah dilalui oleh penulis akan menjadi pelajaran yang berharga untuk melaju ke level yang lebih tinggi. Level yang tidak semua orang berkesempatan untuk mencobanya. Semoga saja akan menjadi happy ending pada akhirnya.

Kuliah kimia masyarakat pada hari Jumat tanggal 20 Maret 2009 yang lalu diisi oleh seorang yang tidak biasanya dari kuliah-kuliah sebelumnya. Sebelumnya dosen tamu menampilkan pembicara seorang pria namun pada kesempatan itu kuliah kimia dan masyarakat menampilkan sosok seorang wanita yaitu Ibu Neli.

Ibu Neli adalah seorang direktur sebuah perusahaan yang bergerak di bidang pengadaan alat-alat diagnosis. Dalam hal ini beliau menjadi agen alat-salat diagnosi yang berasal dari luar negeri khususnya yang berasal dari Amerika. Alat-alat diagnosis tersebut berasal dari perusahaan-perusahaan terkenal seperti Biorad (USA), Promega dan lain lain.

Alat-alat diagnosis harus diimpor dari luar negeri karena bangsa Indonesia belum mampu memproduksi alat-alat seperti itu. Oleh karena itu Bu Neli bersama perusahaannya yaitu Diastika menjadi agen untuk pengadaan alat-alat diagnosis di Indonesia. Usaha Beliau mencakup seluruh wilayah Indonesia dan target pasarnya adalah laboratorium klinis, laboratorium penelitian, laboratorium farmasi, institusi swasta dan pemerintah yang bergerak dalam bidang penelitian dan universitas.

Usaha  Beliau sekarang sangat menjanjikan karena sekarang ini alat-alat seperti itu diperlukan seiring kemajuan dalam bidang bioteknologi dan kedokteran. Selain itu juga  prospek pasar yang menjadi sasaran pun cukup mudah yaitu laboratorium penelitian dan rumah sakit. Hal ini berbeda dengan-usaha lain yang mempunyai pasar heterogen. Jadi dalam hal ini kepercayaan merupkan sesuatu yang patut dikedepankan untuk merebut pasar.

Dalam kuliahnnya beliau membicarakan tentang penggunaan HPLC dalam mendiagnosis penyakit  thalasemia dan diabetes mellitus. Dalam kuliahnya beliau mengedepankan sisi pengguanan  alat diagnosis seperti HPLC, spektrofotometri dan lain-lain. Oleh karena itu dalam resume ini penulis lebih mengedepankan tentang penggunaan alat diagnosis untuk mengobati penyakit. Khusus untuk thalasemia dan diabetes mellitus penulis akan membicarakan sekilas saja tidak akan mendalam.

Dalam resume ini penulis akan membicarakan bagaimana seharusnya kita  membuat alat diagnosis sendiri dan tidak perlu mengimpor dari negara lain. Penulis akan berbiacara mengenai tahapan-tahapa untuk membuat alat diagnosis yang baru khususnya alat diagnosis untuk mendeteksi adanya virus dengue.

Demam dengue (dengue fever, DF) dan beberapa manifestasinya, yaitu Dengue Hemmorhagic Fever (DHF) dan Dengue Shock Syndrome (DSS), disebabkan oleh infeksi virus dengue yang disebarkan melalui vektor nyamuk Aedes aegepty (Henchal, 1990) yang termasuk kedalam keluarga flaviviridae. Virus ini termasuk virus arbovirus yaitu ditransmisikan oleh vektor lain yaitu nyamuk.  Virus dengue memiliki empat jenis serotipe, yaitu serotipe 1, 2, 3 dan 4 dengan diantara ke empat serotipe tersebut memiliki hubungan dekat dalam hal perbedaan antigennya.

Infeksi yang disebabkan oleh virus dengue biasanya tidak dapat di lihat secara klinis ataupun hasil klinis menunjukkan sakit febrille yang tidak spesifik, DF atau DHF. Adanya kerusakan plasma darah yang parah dapat mengakibatkan DHF dimana angka kematian untuk pasien tanpa pengobatan akan mencapai 40-50 % (AnandaRao et al., 2005).

Diagnosis awal terhadap infeksi virus dengue yang diikuti dengan penanganan yang intensif dan juga penanganan gejala-gejala DF melalui penggantian cairan tubuh merupakan kunci utama dalam menangani infeksi dengue.

Map: World distribution of dengue viruses and their mosquito vector, Aedes aegypti, in 2005

Gambar distriribusi virus dengue dan vektor Aedes aegypti pada tahun 2005

Sumber: http://www.cdc.gov

Diagnosis terhadap infeksi dengue dapat dideteksi melalui beberapa metoda, yaitu identifikasi virus dengue, antigen-pengkode virus, genomik RNA virus, dan juga produksi antibodi yang di induksi oleh virus. Identifikasi virus dengue melalui proses isolasi virus tersebut dapat memakan waktu beberapa hari dan juga tidak selalu berhasil mengingat sedikitnya jumlah virus yang mampu bertahan hidup pada sampel plasma darah pasien. Antigen viral dapat dideteksi melalui immunohistochemistry atau immunofluorescence. Akan tetapi, karena komlpeksnya proses dan juga mahalnya biaya pengujian ini menyebabkan pengujian melalui metoda immunohistochemistry jarang digunakan.

RNA viral dapat dideteksi menggunakan reverse transcription and polymerase chain reaction (RTPCR), akan tetapi seperti diagnosis yang lainnya, proses RTPCR mambutuhkan alat yang sangat rumit dan juga mahal. Sehingga dari beberapa metode identifikasi infeksi yang disebabkan oleh virus dengue, maka diperlukan metode yang lebih sederhana, cepat dan juga murah untuk proses identifikasi infeksi yang disebabkan oleh virus dengue.

Beberapa jenis alat diagnosis dengue, dalam berbagai format, dapat ditemukan di pasaran pada saat ini. Kebanyakan dari alat diagnosis tersebut bergantung pada penggunaan antigen virus secara keseluruhan (diproduksi secara kultur jaringan) untuk mendeteksi antibodi anti-gen yang terdapat pada sera pasien, sehingga sangat berhubungan sekali dengan resiko yang ditimbulkan bawaannya.

Diantara alat diagnosis dengue, terdapat satu alat diagnosa yang telah mengganti antigen virus keseluruhan dengan protein envelope dengue yang di ekspresikan pada serangga yang dapat menghilangkan resiko bawaan tersebut. Akan tetapi alat-alat diagnosis dengue tersebut memiliki nilai ekonomis yang tinggi dikarenakan proses produksi antigen, sehingga pembuatan alat-alat diagnosis tersebut tidak dapat terjangkau untuk negara-negara berkembang.

Dari permasalahan diatas, maka diperlukan adanya suatu metoda identifikasi terhadap infeksi yang disebabkan oleh virus dengue yang mudah, murah dan juga aman yang menggabungkan antara sensitifitas dan spesifisitas.

Kebetulan penulis sedikit tahu mengenai proyek ini karena dalam tugas proyek khusus seester ini temanya tidak jauh berbeda. Dalam tugas proyek khusus penulis mengambil tema kloning pengkode epitop immunoglobulin (IgG) virus dengue. Tema proyek khusus penulis ini cukup menarik karena nantinya direncanakan untuk membuat alat diagnosis virus dengue yang menyebabkan penyakit demam berdarah.

Mean Annual Number of DHF Cases
Thailand, Indonesia and Vietnam, by Decade

* Provisional data through 1998

Gambar: grafik jumlah kasus demam berdarah dengue di Indonesia, Thailand dan Vietnam

Sumber: http://www.cdc.gov

Sementara kita tahu kasus demam berdarah di Indonesia terus meningkat dalam beberapa dekade. Kasus demam berdarah hampir setiap tahun terjadi di Indonesia khususnya pada musim hujan. Alat pendeteksi demam berdarah ini sudah ada tetapi cukup mahal. Apalagi kasusnya terjadi di beberapa negara tropis seperti Indonesia yaitu negara berkembang.

Kita cukup kesulitan untuk mendatangkan alat-alat diagnosis yang sudah ada seperti ELISA karena harganya memang sangat mahal sehingga tidak terjangkau. Saya mungkin berpikir kenapa kita harus mengimpor alat- alat diagnosis seperti itu dari negara lain  sedangkan wabahnya kita yang mengalami bukan negara subtropis seperti  Amerika. Kasus-kasus demam berdarah misalnya, penyakit ini mewabah di sekitar negara tropis  yang disebabkan oleh vektor yaitu nyamuk Aedes aegepti. Nyamuk ini membawa virus dengue dan menularkannya ke manusia lewat gigitan nyamuk. Jadi virus dengue adalah arbovirus yang ditransmisikan oleh vektor nyamuk.

Kasusnya mungkin serupa dengan kasus NAMRU yang diblokir oleh Menteri kesehatan. Negara-negara maju seperti Amerika lebih pintar daripada kita. Mereka meneliti vektor-vektor penyakit yang ada di Indonesia seperti virus H5N1, dengue dan lain lain. Kemudian sampel tersebut mereka ambil dan dibawa kenegaranya untuk diteliti. Setelah berhasil dengan penemuan obat-obatan dan berbagai alat diagnosis maka mereka jual alat-alat dan obat tersebut  ke Indonesia. Jadi kita celaka dua kali, seperti telah jatuh tertimpa tangga, sudah sial tambah sial lagi. Maka sekarang kita tergantung dengan negara-negara seperti Amerika karena mereka lebih maju daripada kita.

Oleh karena itu kita sebagai calon ilmuan harus lebih pintar. Penyakit yang ada di Indonesia harus diteliti oleh orang Indonesia khususnya calon-calon ilmuan dari kimia ITB. Jangan sampai kita tergantung terus pada negara lain.

Penulis berpikir ini adalah perang pada zaman sekarang. Perang sekarang lebih berbahaya daripada perang dunia I atau perang dunia II. Pada zaman tersebut yang dinamakan  perang adalah saring tos-tosan senjata, tembak menembak dan akahirnya bencananya langsung dapat dirasakan. Tetapi yang dinamakan perang pada zaman sekarang adalah ketergantungan kita pada Negara lain karena lemahnya ilmu pengetahuan dan teknologi.

Oleh karena itu saatnya kita mulai memproduksi ilmu pengetahuan dan teknologi sendiri dan mengembangkan alat diagnosis sendiri. Alat diagnosis yang akan penulis buat adalah pendeteksi virus dengue penyebab demam berdarah.

Dari jurnal yang penulis peroleh misalnya dilaporkan ada beberapa daerah epitop dari virus dengue. Epitop adalah suatu daerah tertentu pada protein tempat penempelan antara antibodi yang dihasilkan pasien dengan bagian protein yang dihasilkan oleh virus dengue.  Dengan mengetahui daerah tersebut maka kita cukup merancang secara sintetis protein tersebut (epitop protein dengue) ke dalam sebuah material alat pendeteksi. Material yang telah mengandung epitop protein dengue tersebut misalkan saja akan berpendar (fluresensi) ketika kita teteskan serum darah pasien yang diduga terinfeksi dengue.

Jika memang alat tersebut berpendar berarti sudah terjadi ikatan antara antibodi yang pasien hasilkan dengan multioepitop protein dengue. Kalau kita misalkan antibodi yang spesifik kita hasilkan untuk melawan serangan dengue berarti kita sudah terinfeksi virus dengue. Dan kalau misalkan responnya negatif berarti  kita tidak terinfeksi virus dengue.

Alat-alat seperti ini mirip seperti alat tes kehamilan yang dapat dilihat positif hamil tau tidaknya dengan melihat jumlah strip yang dihasilkan. Saya tidak tahu strip satu atau strip dua untuk mendeteksi hamil atau tidaknya karena saya tidak akan pernah hamil. Maaf kalau alasan ketidaktahuan saya itu tidak ilmiah.

Prinsip utama dari tes kehamilan adalah mendeteksi hormon spesifik yang dihasilkan ketika mengalami kehamilan. Hormon tersebut hanya akan dihasilkan kalau wanita itu hamil. Jadi kita dapat mengetahui seorang wanita itu hamil atau tidak dengan mengetes hormon tesebut.

Dengan landasan seperti itu kita juga bisa mengetes atau mendiagnosis penyakit-penyakit yang lainnya yang didasarkan pada hal-hal  speisfik yang dihasilkan. Maka kita dapat dengan mudah membuat alat diagnosis sendiri termasuk mendiagnosis dengue dengan cara mengetes antibodi yang dihasilkan.

Roadmap penelitaian yang akan penulis jalani ada beberapa tahapan. Tahap penelitian pertama diantaranya mengembangkan protein multiepitop dengue rekombinan yang dapat mendeteksi antibodi Immunoglobulin G (IgG) serta mengisolasi dan memurnikan protein multiepitop dengue rekombinan tersebut. Tahap kedua adalah memproduksi multiepitop protein dengue dalam skala yang lebih besar. Tahap ketiga adalah  adalah penelitian

Gambar: tes fluresensi antibodi

Sumber: http://www.cdc.gov

mengenai aplikasi terhadap multiepitop yang telah diteliti sebelumnya denga cara mengaplikasikan ke dalam sebuah material pendeteksi berbasis imunokromatografi dan atau imunofluresensi. Tahap keempat adalah mencari mitra kerja untuk bekerjasama mengembangkan alat diagnosis ini. Tahap kelima adalah membangun sebuah perusahaan seperti Promega, Biorad di Indonesia. Tahap  terakhir adalah kembali ke laboratorium untuk  meneliti alat pendiagnosis lainnya yang berguna untuk kesejahteraaan manusia. Semoga saja rencana penelitian penulis ini berhasil.

Tahap pertama penelitian adalah memepelajari multioepitop protein dengue yang spesisfik terhadap immunoglobulin G. Dari jurnal yang penulis peroleh ternyata multiepitop protein tersebut telah dipublikasikan diantaranya multiepitop protein yang spesifik terhadap IgG (r-DME-G).

R-DME-G protein (recombinant dengue multiepitope protein, specific to IgG) dapat digunakan sebagai alat diagnosis untuk merespon immunoglobin IgG yang dihasilkan saat virus dengue berada dalam tubuh pasien. Lokasi epitop pada poliprotein virus dengue dan urutannnya dapat dilihat pada gambar 1.

Dari hasil penelitian ternyata ada 15 epitop yang terdapat pada virus dengue, delapan dari E (envelope) protein, enam dari NSI dan satu dari NS3 (AnandaRao et al, 2005). Multiepitop ini memiliki 6 sampai 20 residu asam amino. Epitop setiap serotip virus dengue berbeda-beda, serotip dengue 1 terdapat pada epitop 9,  serotip 2 (epitop1-8 dan 10), serotip 4 (epitop 11-15) dan dari hasil penelitaian AnandaRao ternyata  serotip 3 belum didokumentasikan.

Gambar 1: lokasi epitop pada poliprotein virus dengue. Gambar ini merepresentasikan poliprotein virus dengue. Tanda asterisk menandakan epitop yang terdiri dari 1-15 dan tanda panah menyatakan jumlah asam amino yang terdapatpada epitop tersebut.

Sumber: (AnandaRao et al, 2005)

Setelah kita mengetahui multiepitop pada setiap serotip gen dengue yang dihasilkan. Selanjutnya kita harus menerjemahkannya ke dalam kode DNA. Sebagaimana kita tahu dalam dogma sentral itu ada tiga tahapan. Pertama dari kode genetik DNA yaitu basa guanine (G), timin (T), adenine (A) dan sitosin (C) disusun sedemikian rupa dengan susunan tertetu untuk mengkode protein yang disebut gen. Gen tersebut kemudian ditranskripsi ke dalam messenger RNA (mRNA) yang selanjutnya ditranslasi menjadi urutan protein.

Protein inilah yang selanjutnya dihasilkan oleh virus dengue dan menimbulkan respon antibodi kita khususnya immunoglobulin G. Setelah kita tahu mengenai urutan protein yang dihasilkan, kita bisa mensintesis kode genetik DNA tersebut. Perusahaan yang memberikan jasa pelayanan sintesis DNA yaitu diantaranya yang saya tahu itu adalah DNA 2.0 yang berada di Amerika. Indonesia belum bisa mensintesis sendiri oleh karena itu bisnis yang bergerak dalam bidang bioteknologi sangat prospektif dikembangkan di Indonesia.

Gen sintesis yang akan  dikloning  mengkode r-DME-G protein dan diprediksi mengkode sekitar 25 kDa rekombinan protein yang terdiri dari 15 epitop. Prediksi urutan asam amino pada r-DME-G protein dapat dilihat pada gambar 2A dan analisis model struktur r-DME-G protein dapat dilihat pada gambar 2B.

Gen sintetis epitop dengue ini kemudian dikloning atau ditempatkan dalam sebuah plasmid bakteri yang selanjutnya disebut vektor. Sedikit informasi saja bahwa setiap asam amino (protein adalah polimer dari asam amino) yang dihasilkan dikode oleh setiap tiga basa. Misalkan saja pada gambar diatas asam amino pertama disintesis adalah M (metionin) jadi urutan DNA sintesisnya adalah ATG (adenin-timin-guanin). Selanjutnya setiap asam amino dikode oleh tiga

Gambar 2 : Desain r-DME-G protein. (A) Urutan Asam amino dari r-DME-G protein pada gambar 1. Epitop asam amino ditulis dengan huruf normal dan rantai trigliseril ditulis dengan huruf tebal. Dalam tiga epitop tersebut residu karboksi terminal ditandai dengan asterik yaitu G dan merupakan bagian dari rantai trigliseril. Residu amino terminal 1-4 dan residu karboksi terminal 8 sampai dengan 6xHis tag yang digambarkan dengan huruf tebal adalah hasil pengkodean oleh urutan plasmid asal. (B) Visualisasi r-DME-G protein dengan menggunakan ViewerLite Software.

Sumber: (AnandaRao et al, 2005)

basa yang dikombinasi dengan khas sesuai dengan  asam amino yang dikode. Berikut adalah beberapa kode genetik dari epitop protein yang dihasilkan virus dengue.

ATGGGTGGTTCGGAGACCTTGGTTACCTTCAAAAATCCTCACGCAAAAAAGCAG

MetGlyGlySerGluThrLeuValThrPheLysAsnProHisAlaLysLysGln

GACGTGGTCGTGCTGGGTAGCGGCGGTGGCAACCTGCTGTTCACCGGTGGTGGC

AspValValValLeuGlySerGlyGlyGlyAsnLeuLeuPheThrGlyGlyGly

CCGTTCGGTGATAGCTATATCATTATCGGTGTG… dan seterusnya

ProPheGlyAspSerTyrIleIleIleGlyVal

Menariknya bioteknologi adalah kita bisa menguasasi kode-kode kehidupan. Saya pernah mendengar dari seorang ilmuan biokimia bahwa kalau kita sudah menguasai apa arti dari kode-kode genetik tersebut maka bahasa hiperbolanya berbunyi “Kita setidaknya telah mengerjakan sebagian pekerjaan Tuhan”.

Karena yang membedakan manusia dengan organisme lain seperti monyet dan cacing terletak pada kondisi kode-kode seperti ini. Kode genetik yang berbeda akan menghasilkan protein yang berbeda pula, sehingga jalur metabolismenya pun berbeda dan secara fisik akan berbeda juga.

Jadi Tuhan hanya mempunyai empat kode (A,T,G,C) untuk membuat suatu organisme hidup. Tuhan hanya mengkombinasikan ketiga basa tersebuat untuk menyusun makhluk hidup.

Ternyata ilmu tentang alam (biologi) lebih hebat daripada ilmu manapun termasuk bidang teknologi informasi yang sering dibanggakan oleh mahasiswa informatika. Komputer hanya mempunyai dua kode yaitu Yes dan No berbeda dengan kehidupan yaitu kombinasi antara A, T, G, dan C.

Lalu setelah kita tahu kombinsi dari kode genetik yang akan diproduksi untuk menghasilkan epitop protein dengue yang berasal dari kode genetik sintesis. Tahap selanjutnya adalah tahap sintesis protein dari kombinasi kode genetik tersebut.

Tahap sintesis protein adalah tahap yang sangat menyenangkan karena tahap ini adalah tahap yang paling santai bagi manuasia. Tetapi  tahap yang sebaliknya bagi bakteri seperti Escherichia coli yang dipakasa untuk mengekspresikan protein yang kita inginkan.

Dalam tahap ini bakteri adalah host untuk menghasilakan protein epitop dengue. Jadi kode genetik epitop dengue yang teklah kita sintesis sebelumnya dikloning ke dalam tubuh bakteri dengan menggunakan sebuah vektor ekspresi seperti plasmid pGEM-T dengan teknik DNA rekombinan. Jadi intinya kode genetik yang telah kita sintesis ditransformasi ke dalam bakteri, dan bakteri tersebut dipaksa untuk memproduksi protein dengue yang kita inginkan.

Alasan kenapa digunakan bakteri untuk menghasilkan protein adalah karena siklus replikasi bakteri yang lebih singkat. Bakteri dapat membelah diri menjadi dua dalam waktu yang singkat misalkan saja untuk kasus E. coli , bakteri ini membelah setiap 20 menit sekali. Jadi protein yang dihasilkan pun akan banyak dan lebih cepat.

Selanjutnya protein epitop dengue akan dihasilkan oleh bakteri misalnya Escherichia coli.  Proses sintesis protein ini dilakukan oleh bakteri dalam sebuah bioreaktor. Jadi tugas kita cukup mudah kita hanya menyediakan nutrisi buat bakteri, oksigen, cahaya dan kondisi fisiko-kimia yang mendukung.

Inilah yang dianaman bioteknologi. Bioteknologi adalah teknologi yang berasal dari alam karena alam menginspirasi kita. Kita tidak harus susah-susah mensintesis suatu senyawa dengan sintesis kimia yang tidak gampang, mari kita serahkan sepenuhnya pada alam. Biarkan alam memberikannya buat kita, Itu adalah konsep pertama yang dipelajari dari bioteknologi.

Setelah kita memproduksi protein epitop protein dengue dengan menggunakan bioreaktor, tahap selanjutnya adalah mengaplikasikan protein tesebut sehingga membentuk sebuah plat material yang terbuat dari serangkaian protein epitop dengue. Untuk tahap pembuatan alat diagnosis dengan menggunakan suatu pelat yang mirip pelat KLT (kromatografi lapis tipis) ini penulis harus belajar banyak dari mata kuliah kimia material yang belum penulis ambil pada semester ini. Kalau misalkan penulis sudah mengambil kuliah kimia material, pada kesempatan lain penulis akan berbicara lebih banyak.

Namun pada intinya pembuatan pelat material yang berisi serangkaian epitop protein virus dengue ini berbasis teknik imunokromatogtrafi dan atau imunofluresensi. Prinsip dari teknik ini yaitu mengguanakan pelat yang akan berpendar seandainya ada antibodi yang spesifik terhadap dengue dalam serum darah pasien yang berikatan dengan protein yang berada pada pelat imunokromatografi atau imunofluresensi.

Namun bisa juga protein dengue yang diproduksi oleh bakteri dalam skala besar ini digunakan dalam bentuk cairan tetes. Artinya untuk mengetes adanya antibodi terhadap dengue dalam tubuh maka serum darah direaksikan dengan protein epitop dengue dan hasil positif dapat dilihat dari perubahan warna hasil reaksi antara protein epitop dengue dengan serum darah.

Jadi kesimpulannya kita juga bisa mengembangkan suatu alat diagnosis dengue yang sederhana, sepat, mudah, murah dan akurat dengan cara menggunakan protein epitop dengue berbasis imunokromatografi dan atau imunofluresensi.

Untuk sekarang memang kita cukup leluasa mengguankan bakteri untuk dimanfaatkan dalam kehidupan manusia seperti produksi obat, insulin dan sintesis protein. Kita jujur saja telah mengeksploitasi seluruh potensi  dari bakteri sampai bakteri itu mati.  Menurut Bu Marlia Singgih Wibowo (dosen Sekolah Farmasi ITB) akan ada ada masalah kalau kita terus menerus mengeksploitasi  bakteri. Mungkin saja menurut beliau suatu saat nanti akan ada perkumpulan pecinta bakteri mirip perkumpulan pecinta binatang. Jadi kita tidak bebas mengeksploitasi bakteri untuk dimanfaatkan karena akan diprotes oleh para pecinta bakteri.  Saya cukup tergelitik dengan peryataan Bu Marlia itu, apakah akan ada perkumpulan pecinta bakteri. Kalau memang ada sungguh merupakan perkumpulan yang sangat konyol. Mereka lebih suka membela bakteri daripada manusia.

Kasusnya sama seperti perkumpulan pecinta binatang. Mereka membela bintang yang dibunuh dalam percobaan. Satu hal yang tidak dimengerti oleh akal kita yang normal adalah mereka lebih suka mencintai selain manusia seperti binatang daripada mencintai sesamanya yang sedang terserang penyakit. Tujuan penggunaan binatang dalam percobaan itu bukan tidak ada tujuan melainkan untuk mengetes terlebih dahulu sehingga memberikan rasa aman sebelum diberikan kepada manusia. Mari kita bayangkan apakah kita tega menggunakan manusia sebagai kelinci percobaan.  Orang yang normal pasti mengatakan tidak.

Paragraf diatas merupakan selingan saja biar kening para pembaca tidak terlalu berkerut  karena penulis merasa tulisan resume pada kali ini cukup ilmiah dibandingkan dengan resume–resume  sebelumnya. Oleh karena itu selingan perlu disisipkan pada setiap bagian agar tidak terlalu ilmiah.

Selanjutnya penulis akan membahas masalah yang lebih serius yaitu mengenai kemandegan teknologi di Indonesia khususnya di ITB. Salah satu alasan menurut Bu Pingkan Aditiawati (wakil dekan SITH ITB) adalah karena mahasiswa-mahasiswa ITB kehilanggan inspirasi. Bu Pingkan berpendapat bahwa inspirasi yang hebat itu berasal dari alam. Misalkan saja penggunaan membran pada industri, semuanya itu terinspirasi dari kehebatan memebran sel yang selektif terhadap zat-zat yang masuk ke dalam sel. Dan sampai sekarang belum biasa dirancang sebuah membran sehebat membran sel.

Oleh karena itu untuk menghilangkan kemandegan inspirasi maka semenjak tahun 2008 seluruh mahasiswa  ITB  pada Tahap Persiaan Bersama (TPB) memperoleh  mata kuliah alam semesta yang merupakan bagian dari matakuliah biologi dasar. Hal tersebut dilakukan untuk menghilanngkan kemandegan inspirasi dalam mengembangkan teknologi.

Dengan perkembangan bioteknologi di Indonesia diharapkan nantinya produksi senyawa-senyawa obat seperti insulin buatan untuk mengobati penderita diabetes mellitus. Kadar glukosa dalam darah diatur dengan hormon yang dihasilkan di dalam pankreas, hormon ini dinamakan insulin. Insulin dalah hormon yang mengatur kadar glukosa dalam darah karena dapat merubah glukosa yang berlebih di dalam darah menjadi cadangan energi berupa glikogen. Kekurangan hormon ini menyebakan glukosa dalam darah tidak dapat disimpan sehingga terbuang begitu saja melalui urin. Sehingga hal tersebut akan mempengaruhi metabolisme sel yang lain seperti metabolisme protein dan metabolism lipid oleh karena itu akibat kekurangan insulin atau sel pankreas tidak dapat memproduksi sama sekali maka timbul penyakit yang dinamakan kencing manis atau diabetes melitus.

Diabetes mellitus ini ada beberapa tahap ada diabetes mellitus tipe satu dan dua. Diabetes tipe satu adalah tipe diabetes yang mempunyai ketergantungan tehadap insulin karena sel pankreas tidak bisa memproduksi hormon ini atau memproduksi dalam jumlah sangat sedikit. Biasanya penyakit ini mulai terjadi pada remaja sekitar usia 15 tahun. Oleh karena itu perlu adanya suntik insulin sampai empat kali sehari. Insulin yang dimasukan dalam tubuh harus dengan suntikan karena kalau secara oral dimakan maka hormon ini akan hancur dalam sistem pencernaan. Penyakit diabetes tipe satu ini termasuk penyakit autoimun karena sistem pertahanan tubuh merusak sel penghasil insulin yang disebut beta sel.

Sedangkan diabetes mellitus tipe dua tidak tergantung insulin artinya kadar glukosa dalam darahnya masih bisa dikontrol  karena masih memproduksi insulin. Oleh karena itu diet yang tepat sangat penting unttuk menjaga kondisi gula dalam darah. Biasanya penyakit diabetes tipe 2 terjadi pada manusia yang sudah berumur 45 tahun ke atas.

Salah satu perawatan yang sederhana untuk menjaga kadar glukosa dalam darah tetep normal adalah memakan makanan yang tidak mengandung glukosa, salah satu contoh diantaranya memakan buah-buahan. Buah-buahan sangat cocok sekali karena mengandung fruktosa yang sedikit berbeda metabolismenya dengan glukosa.

Selain itui perkembangan rekayasa genetika membuat kita lebih mudah untuk mendapatkan insulin. Sebelum rekayasa mulai berkembang pada waktu dulu orang-orang mendapatkan insulin dari sapi. Tetapi sekarang lebih mudah cukup kita memindahkan gen penghasil insulin ke dalam plasmid bakteri dengan teknik rekombinan DNA, dengan cara seperti itu sel bakteri dipaksa untuk mengkspresikan gen tersebut dalam bentuk hormon insulin. Salah satu alasan lagi kenapa  dilakukan ekspresi insulin pada bakteri karena bakteri lebih mudah berkembang biak berbeda sekali dengan sapi yang memerlukan waktu  beberapa tahun untuk tumbuh.

Evaluasi Kuliah

Kuliah kimia dan masyarakat pada  tanggal 20 Maret 2009 sungguh sangat spesial bagi penulis karena akhirnya ada juga dosen tamu seorang wanita. Apalagi yang datang pada kesempatan itu adalah Bu Neli seorang direktur sebuah perusahaan alat-alat diagnosis.

Saya berpikir kuliah dosen pada hari itu diisi oleh seorang dosen kimia ITB yaitu Dr. Lia Juliawati tetapi ternyata bukan. Wajah Bu Neli ini nampak dari kejauhan mirip seperti Bu Lia. Saya melihat dari warna kulit, bentuk muka dan posturnya itu sangat mirip sekali.

Bu Neli cukup memberikan nuansa yang berbeda pada waktu itu. Saya juga ikut terlarut di dalamnya. Kuliah yang memberikan banyak sekali pelajaran yang sangat berharga yaitu tentang bagaimana membuka usaha dari nol disamping pengetahuan tentang penyakit thalasemia dan diabetes mellitus.

Ilmu yang penulis dapat dari Bu Neli adalah nilai dari sebuah ketekunan, kerja keras, berjiwa besar dan juga berpikir positif. Itulah yang menjadi kunci Beliau dalam mengembangkan usahanya.

Seseorang akan menjadi manusia besar diawali oleh pikirannya. Apabila pikiran manusia hanya berpikir kecil maka manusia tersebut tidak akan pernah menjadi orang-orang yang besar. Sebaliknya apabila manusia berpikir suatu hal yang besar maka manusia tersebut akan menjadi orang-orang yang besar.

Dalam menghadapi pembangunan yang berkelanjutan yang perlu diperhatikan adalah manusia yang berkualitas terutama dalam pemikiran daripada kuantitas manusia yang bekerja dalam pembangunan. Kualitas dari manusia dapat dilihat dari pola pikirnya. Dapat dianalogikan untuk melihat gelas yang berisi setengah air. Apabila manusia melihat gelas tersebut adalah setengah kosong maka manusia tersebut orang yang pesimis. Sebaliknya apabila manusia melihat gelas tersebut adalah setengah isi maka manusia tersebut orang yang optimis.

Dengan pemikiran yang besar dapat membuat manusia menjadi visioner. Manusia visioner merupakan manusia yang bisa melakukan pencapaian-pencapaian besar. Manusia-manusia visioner dapat menjadi golongan creative minority. Creative minority merupakan sekumpulan manusia yang minoritas yang dapat melakukan suatu perubahan besar.

Dalam menjalani hidup, tentu saja kita sebagai manusia selalu ada masalah dan tantangan yang diberikan Tuhan. Apa yang Tuhan berikan itu pastilah untuk menguji kita sebagai hamba apakah tetap berada dijalan-Nya atau tidak. Setiap orang punya masalah tapi yang membedakan orang yang satu dengan yang lain adalah bagaimana orang tersebut me-manage dan menyikapi masalah yang dihadapi.

Secara sadar ataupun tidak, kita sering mengeluh dan berpikir negatif terhadap keadaan atau situasi yang kita alami. Berpikiran negatif kepada sesama manusia saja tidak baik, apalagi kalau kita sampai berpikiran negatif kepada Sang Pencipta.
Keadaan kita tidak akan berubah dari satu kondisi ke kondisi lain, kecuali dengan usaha kita sendiri. Memang semuanya hanya akan terjadi dengan takdir Tuhan, tetapi dalam menjadikan segala sesuatu itu, Tuhan menggunakan sebab. Selama kita belum mengenal hukum perubahan ini dengan baik, maka segala upaya untuk mengatasi rasa cemas atau agar terbebas dari kesusahan, tidak berguna. Kita tidak akan mampu terbebas dari rasa cemas kecuali jika kita sendiri bersikeras untuk mengatasi hal ini.

Luruskan niat. Perbanyak dan optimalkan ikhtiar. Hilangkan penyakit hati. Sering kali kita sendirilah yang membuat rasa cemas terjadi pada diri kita. Juga kita sendiri yang memilih terjadinya kesusahan dan kesedihan. Penyakit ini tentu bukan karena virus akan tetapi penyakit akibat adanya kerusakan pikiran kita dan akibat sedikitnya iman kita kepada Tuhan.

Cintailah orang lain seperti mencintai diri sendiri. Kalimat sederhana itu bermakna dalam karena merupakan hal yang dapat membawa kebahagiaan bagi jiwa manusia. Ketika kita mencintai saudara kita seperti kita mencintai diri sendiri, dada kita akan terasa lapang. Jiwa kita terasa tenang dan kita akan merasakan puncak kepuasan.

Kebahagiaan kita menjadi bertambah ketika kita menanggalkan titik-titik hitam. Titik-titik hitam ini bisa berupa rasa dengki, iri, benci, dendam, dan sebagainya. Jangan bersedih dengan masa lalu. Pikirkan dan  laksanakan masa kini. Persiapkan diri untuk masa depan.

Adanya perasaan sedih karena masa lalu, juga karena mengingat peristiwa masa lalu yang tidak mungkin kembali lagi merupakan suatu kelemahan yang akan menjadikan seseorang terus merasa terus terbelenggu dan hanya akan menjadikannya lemah dan tak berdaya. Hal-hal seperti itulah yang dapat saya dapat dari kuliah kimia dan masyarakat pada waktu itu.

Sebelumnya saya juga tidak menduga bahwa Bu Neli adalah seorang direktur. Karena menurut hemat saya Beliau itu kelihatan tidak mempunyai wajah seorang direktur. Mungkin juga teman-teman yang lain berpendapat hal yang sama dengan penulis.

Tapi pikiran yang harus saya hilangkan adalah menilai orang lain dari segi penampilannya. Walaupun penampilannya tidak mirip seorang direktur tetapi Bu Neli mempunyai nilai-nilai yang mungkin saja melebihi daripada direktur kebanyakan yaitu nilai ketekunan, kerja keras, berjiwa besar dan berpikiran positif. Hal tesebut adalah sesuatu modal berharga yang harus dimiliki oleh setiap orang termasuk harus dimiliki oleh penulis.

Evaluasi  perkuliahan ini dari penulis sedikit saja karena menurut penulis palaksanaan kuliah kimia dan pada masyarakat  pada hari Jumat yang lalu sudah baik. Host person yaitu Gde Sutawijaya telah mengemasnya dengan baik  sehingga saya merasa puas  dengan kuliah pada waktu itu.

Mungkin saja  karena Gde Sutawijaya telah berpenampilan begitu trendy penampilan Bu Mega dan Bu Neli yang cukup modis seperti biasanya sehingga memberikan sugesti positif pada perkuliahan.

Daftar Pustaka

AnandaRaoa, R.,Swaminathana, S., Fernandob, S., Jana, A.M., Khannaa, N., (2005), A custom-designed recombinant multiepitope protein as a dengue diagnostic reagent, Protein Expression and Purification, 41, 136–147.

AnandaRaoa, R.,Swaminathana, S., Fernandob, S., Jana, A.M., Khannaa, N., (2006), Recombinant Multiepitope Protein for Early Detection of Dengue Infections, American Society for Microbiology, 13, 59-67.

K.I. Yamada, T. Takasaki, M. Nawa, I. Kurane, Virus isolation as one of the diagnostic methods for dengue virus infection, J. Clin.Virol. 24 (2002) 203–209.

J. Groen, P. Koraka, J. Velzing, C. Copra, A.D.M.E. Osterhaus,Evaluation of six immunoassays for detection of dengue virus speciWc immunoglobulin M and G antibodies, Clin. Diagn. Lab.

Immunol. 7 (2000) 867–871.

A.J. Cuzzubbo, T.P. Endy, A. Nisalak, S. Kalyanarooj, D.W. Vaughn,S.A. Ogata, D.E. Clements, P.L. Devine, Use of recombinantenvelope proteins for serological diagnosis of dengue virus infectionin an immunochromatographic assay, Clin. Diagn. Lab.Immunol. 8 (2001) 1150–1155.

Rady R. Dypatra, Proposal Penelitian, Kloning Gen Pengkode Epitop IgG Dengue, (2009).

Iman Prawira, Proposal penelitian, Konstruksi antigen rekombinan dengue yang spesifik terhadap antibodi IgG dan IgM, (2008).

http://newsgroups.derkeiler.com/pdf/Archive/Soc/soc.culture.indonesia/2006-09/msg00061.pdf

http://yudistira-himura-naruto.blogspot.com/2009/03/pendidikan-rumah-berperan-dalam.html

http://www.islamonline.net

http://www.cdc.gov

Proses Pembuatan Gula Rafinasi

Kuliah kimia dan masyarakat pada minggu ketiga diisi oleh seorang alumni Kimia yang bernama Arimulyo Nugroho. Beliau yang lebih dikenal dengan panggilan Mas Oho bekerja sebagai sales marketing pada PT Jawamanis Rafinasi. Dalam kuliahnya Mas Oho mempresentasikan tentang pembuatan gula rafinasi khususnya yang dilakukan PT Jawamanis Rafinasi.  Selain itu juga Mas Oho memberikan kuliah tentang bagaimana strategi menguasai pasar.

Hampir sekitar  dua jam Mas Oho memberikan kuliah kimia dan masyarakat namun selebihnya digunakan untuk sesi tanya jawab yang sangat menarik sekali. Pada sesi tanya jawab beliau bercerita ketika masih menjadi mahasiswa kimia ITB. Hal ini menarik bagi kami karena bisa belajar dari pengalamannnya sebagai wakil ketua himpunan dan aktivis pada berbagai organisasi kemahasiswaaan.

Resume yang telah saya susun berisi tentang enam bagian penting. Pada bagian pertama berisi tentang kondisi produksi dan konsumsi gula kasar(raw sugar) di Indonesia pada tahun 2008-2009. Pada bagian kedua berisi tentang cara mengatsi desfisit gula di Indonesia. Lalu pada bagian ketiga berisi tentang bagaimana sintesis sukrosa dalam sel tumbuhan. Selanjutnya pada bagian keempat berisi tentang bagaimana pembuatan gula kasar(raw sugar) dari tebu sebagai sumber sukrosa. Lalu pada bagian kelima berisi tentang cara pembuatan gula rafinasi yang berasal dari gula kasar dan pada bagian akhir berisi tentang evaluasi kuliah kimia dan masyarakat.

Konsumsi dan Produksi Gula Dunia

April 2008-Maret 2009

Satuan: juta ton

Sumber: Kingsman Reports

Pada bagian pertama saya akan menerangkan tentang kondisi gula di Indonesia. Sumber data yang digunakan adalah Kingsman Reports.

Produksi dan Konsumsi Gula Kasar(Raw Sugar) Indonesia

Dari data diatas dapat di ambil kesimpulan bahwa produksi gula kasar(raw sugar) yang ada di Indonesia lebih kecil dari konsumsi  sehingga harus dilakukan impor gula. Seperti istilah lebih besar pasak daripada tiang jika kita umpamakan. Saya cukup kaget melihat data tersebut kalau kita melihat sumber daya yang ada di Indonesia. Sumber daya alam Indonesia memiliki kekayaan alam yang sangat melipah, tanahnya subur dan mayoritas matapencaharian orang Indonesia adalah petani. Namun pertanyaaannya mengapa kita harus mengimpor gula dari luar. Sungguh sangat disayangkan sekali melihat kondisi tersebut sangat memprihatinkan.

Kalau kita cermati tabel tersebut ternyata konsumsi gula kasar(raw sugar) Indonesia dari bulan April 2008 sampai bulan Maret 2009(lihat tabel) adalah 5250 juta ton jauh berbeda dibandingkan dengan produksinya yaitu sekitar 2650 juta ton. Hal itu mencerminkan bahwa bangsa Indonesia hanya mampu memenuhi kebutuhan dalam negeri sekitar setengahnya dari jumlah konsumsi gula kasar. Oleh karena itu untuk memenuhi konsumsi gula dalam negeri maka kebijakan pemerintah tidak ada pilihan lain selain impor gula kasar dan gula putih.

Kebijakan tersebut cukup merugikan para petani gula dan industri gula rumahan karena ternyata  gula putih impor tersebut lebih murah daripada gula putih yang diproduksi di dalam negeri. Selain harganya lebih murah, gula impor juga mempunyai kualitas yang lebih unggul daripada produksi dalam negeri. Kalau kita sering belanja di pasar tradisional  dan coba membandingkan gula impor dan gula produk dalam negeri ternyata gula impor tersebut kualitasnya lebih bagus karena warnanaya yang putih sedangkan gula buatan dalam negeri berwarna kekuningan. Maka konsumen lebih memeilih gula impor daripada gula buatan dalam negeri. Akibatnya produksi gula dalam negeri menjadi tersendat dan merugikan petani gula.

Warna putih gula impor bukan berasal dari pewarnaan tetapi memang teknologinya sudah canggih sehingga output yang cenderung baik. Hal tersebut berbeda sekali dengan gula yang diproduksi dalam negeri yang cenderung kekuningan, hal tersebut disebabkan oleh proses pembuatan gula yang masih menggunakan teknologi yang sederhana. Selain itu juga mesin-mesin pembuat gula yang digunakan adalah mesin yang digunakan pada zaman dulu yang belum diperbaharui.

Sehingga kadang-kadang kita sering mendengar kalimat bahwa gula kuning itu lebih manis daripada gula putih. Sebenarnya isu tersebut adalah untuk melindungi industri gula putih dalam negeri supaya tidak bangkrut. Hal tersebut memang wajar karena kita harus melindungi para petani tebu.

Cara Mengatasi Defisit Gula

Untuk mengurangi defisit gula setidaknya ada beberapa hal yang harus dilakukan diantaranya kebijakan pemerintah untuk menjaga harga gula supaya tidak merugikan produsen dan konsumen,membuka lahan pertanian baru untuk produksi tebu, membuka industri gula yang baru dan disertai peningkatan kualitas teknologi  industri.

Hal-hal seperti itu harus segera dilaksanakan oleh pemerintah karena untuk beberapa tahun kedepan seharusnya kita bisa berswasembada pangan. Dan kabar baik yang telah berhasil ditingkatkan adalah swasembada beras. Oleh karena  tugas kita sebagai kaum intelektual senantiasa berkontribusi untuk bangsa dan negara.

Dengan ketertarikan saya dalam bidang biokimia khususnya bioteknologi, saya mungkin suatu hari nanti dapat menghasilkan suatu penelitaian tentang bagaimana meningkatkan produksi gula dari tebu atau  tanaman yang lain dengan cara memodifikasi gen penghasil sukrosa denga cara rekayasa genetika.

Buah pikiran saya yang ingin diaplikasikan suatu hari nanti adalah bagaimana mensubstitusi gula dengan pemanis lain yang sama sekali bukan buatan seperti aspartam dan sakarin. Dari bacaan dan informasi yang saya dapat ternyata ada pemanis yang berasal dari asam amino. Pemanis ini cukup potensial dikembangkan karena selain tidak berbahaya seperti pemanis buatan  asam amino ini juga bisa didegdradasi dalam siklus metabolisme sel. Pemanis ini sangat cocok untuk penderita Diabetes mellitus. Kita bisa menyisipkan gen pemanis  yang menghasilkan asam amino ini supaya diproduksi dalam jumlah besar baik dalam tanaman membentuk tanaman transgenik atau dilakukan ekspresi protein secara induktif dalam jumlah besar dengan teknik DNA rekombinan pada transforman yang lain seperti bakteri dan jamur. Beberapa tahun ke depan terobosan-terobosan seperti itu cukup menjadi tantangan buat kita dan suatu saat nanti kita bisa membuka produksi tanaman tebu hasil rekayasa genetika  dengan produksi sukrosa yang melimpah.

Tahap Proses Pembuatan Sukrosa Dalam Sel Tanaman

Dengan cara memahami jalur metabolisme tumbuhan kita dapat menjelaskan bagaimana proses pembutan sukrosa dalam sel. Proses pembuatan sukrosa dalam sel dimulai dari tahap fotosintesis. Proses fotosintesis terjadi pada bagaian kloroplas yang terdapat dalam daun tanaman.  Proses ini dibedakan menjadi dua yaitiu reaksi terang dan reaksi gelap. Reaksi terang memerlukan cahaya matahari sebagai sumber energi untuk mengaktifkan reaksi sedangkan reaksi gelap memerlukan ATP sebagai sumber energi.

Proses fotosintesis memerlukan CO2, H2O dan cahaya yang berasal dari sinar matahari. Pada tahap pertama terjadi fiksasai CO2 dengan lima aseptor karbon yaitu ribulosa 1,5-bisfosfat membentuk 3-fosfogliserat. Molekul ini adalah prekursor pembentukan berbagai biomolekul yaitu karbohidrat, gula, sukrosa dan polisakarida yang lainnya.

Tahap kedua setelah proses fiksasi CO2 yaitu pengubahan 3-fosfogliserat menjadi gliseraldehid 3-fosfat. Tahap ini dikenal sebagai tahap reaksi gelap yaitu proses reduksi yang memerlukan ATP dan NADPH. Gliseraldehid 3-fosfat adalah prekursor terjadinya beberapa reaksi metabolisme dalam sel seperti proses glikolisis  dan glikoneogenesis.

Molekul gliseraldehid 3-fosfat yang berasal dari kloroplas berkondensasi memebentuk fruktosa 1,6 bisfosfat yang dikatalisis oleh enzim aldolase. Selanjutnya terjadi hidrolisis memebentuk fruktosa 6-fosfat. Lalu dengan menggunakan enzim sukrosa 6-fosfat sintase terjadi pengubahan fruktosa 6-fosfat menjadi UDP-glukosa  membentuk sukrosa 6-fosfat. Terakhir  enzim sukrosa 6-fosfat fosfatase menghilangkan gugus fosfat dan menghasilkan sukrosa yang siap diangkut ke seluruh jaringan tanaman.

Proses Pemanenan Tanaman Tebu

Setelah mempelajari bagaimana siklus terjadinya pembentukan sukrosa dalam skala molekul selanjutnya bahasan beralih pada tahap proses pemanenan tanaman tebu. Sampai saat ini gula tebu masih sangat primadona untuk dijadikan sebagai bahan baku pembuatan gula. Karena tanaman tebu memiliki kandungan sukrosa yang sangat banyak di bandingkan dengan tananaman yang lain. Tanaman tebu yang digunakan untuk skala industri  ini dapat diperoleh dari perkebunan tebu  para petani.

Tanaman tebu yang dapat mencapai ketinggian tiga meter ini dapat dipanen  setelah daun-daunnya mengering. Tanaman tebu ini pertama-tama dibersihkan terlebih dahulu dengan cara pembakaran. Pembakaran ini jangan sampai batangnya terbakar tetapi cukup sampai dengan pembakaran daun dan lapisan lilin pada batang. Untuk mengantisispasi terbakarnya batang maka  yang perlu dilakukan adalah mengguanakan api yang sangat panas dengan cara sekejap supaya batang tebunya tidak rusak.

Setelah itu tanaman tebu dipotong-potong. Proses pemotongan ini bisa dilakukan dengan cara manual atau dengan menggunakan mesin. Keuntungan yang diperoleh dengan menggunakan mesin adalah lebih cepat tetapi memerlukan biaya yang tidak sedikit. Oleh karena itu ada juga yang dilakukan secaa manual, keuntungan dari proses ini adalah membuka lapangan pekerjaan bagi para pekerja kasar. Tapi hasil yang diperoleh pun tidak secepat yang dilakukan oleh mesin. Maka hal tersebut merupakan suatu pilihan bagi para produsen tergantung kebutuhannya.

Proses Pembuatan Gula Kasar(Raw Sugar)

Tahap pertama pengolahan setelah proses pemanenan adalah ekstraksi jus atau sari tebu. Di kebanyakan pabrik, tebu dihancurkan dalam sebuah serial penggiling putar yang berukuran besar. Penggilingan ini bertujuan agar sari tebu atau jus tebu itu keluar dan serat tebu, hal ini mirip seperti cara kita membuat jus buah, tapi bedanya ampasnya dipisahkan pada proses ini. Cairan tebu manis dikeluarkan dan serat tebu dipisahkan. Ampas tebu ini merupakan limbah yang dapat dimanfaatkan untuk pakan ternak, dijadikan pupuk dan lain-lain.

Sedangkan cairan tebu  selanjutnya digunakan di mesin pemanas. Sari tebu yang dihasilkan masih berupa cairan yang kotor yaitu masih berupa sisa-sisa tanah yang berasal dari debu yang menempel pada batang tebu atau bisa juga berasal dari debu  proses pengangkutan, serat-serat berukuran kecil yang ikut terbawa  dan ekstrak dari daun dan kulit tanaman, semuanya bercampur di dalam cairan tebu. Jus dari hasil ekstraksi mengandung sekitar 15% gula dan serat residu, dinamakan bagasse, yang mengandung 1 hingga 2% gula, sekitar 50% air serta pasir dan batu-batu kecil dari lahan yang terhitung sebagai “abu”. Sebuah tebu bisa mengandung 12% hingga 14% serat dimana untuk setiap 50% air mengandung sekitar 25 hingga 30 ton bagasse untuk tiap 100 ton tebu atau 10 ton gula.

Pabrik dapat membersihkan jus dengan mudah dengan menggunakan semacam kapur yang akan mengendapkan sebanyak mungkin kotoran untuk kemudian kotoran ini dapat dikirim kembali ke lahan. Proses ini dinamakan pengapuran(liming). Proses ini mirip seperti proses penghilangan warna dengan menggunakan karbon aktif. Jus hasil ekstraksi dipanaskan sebelum dilakukan liming untuk mengoptimalkan proses penjernihan dan kotoran-kotoran yang terlarut didalamnya menjadi fragmen-fragmen yang lebih halus dan mudah untuk dipisahkan.

Kapur berupa kalsium hidroksida atau Ca(OH)2 dicampurkan ke dalam jus dengan perbandingan yang diinginkan dan jus yang sudah diberi kapur ini kemudian dimasukkan ke dalam tangki pengendap gravitasi yaitu sebuah tangki penjernih. Jus mengalir melalui tangki penjernih dengan kelajuan yang rendah sehingga padatan dapat mengendap dan jus yang keluar merupakan jus yang jernih.

Kotoran berupa lumpur dari tangki penjernih masih mengandung sejumlah gula sehingga biasanya dilakukan penyaringan dalam penyaring vakum putar(rotasi) dimana jus residu diekstraksi dan lumpur tersebut dapat dibersihkan sebelum dikeluarkan, dan hasilnya berupa cairan yang manis. Jus dan cairan manis ini kemudian dikembalikan ke proses untuk dilakukan tahapan selanjutnya.

Setelah mengalami proses liming, jus dikentalkan menjadi sirup dengan cara menguapkan air menggunakan uap panas dalam suatu proses yang dinamakan evaporasi.

Terkadang sirup dibersihkan lagi tetapi lebih sering langsung menuju ke tahap pembuatan kristal tanpa adanya pembersihan lagi. Jus yang sudah jernih mungkin hanya mengandung 15% gula tetapi cairan(liquor) gula jenuh(yaitu cairan yang diperlukan dalam proses kristalisasi) memiliki kandungan gula hingga 80%. Evaporasi dalam evaporator majemuk(multiple effect evaporator) yang dipanaskan dengan steam merupakan cara yang terbaik untuk bisa mendapatkan kondisi mendekati kejenuhan (saturasi).

Pada tahap akhir pengolahan, sirup ditempatkan ke dalam panci yang sangat besar untuk dididihkan. Di dalam panci ini sejumlah air diuapkan sehingga kondisi untuk pertumbuhan kristal gula tercapai. Pembentukan kristal diawali dengan mencampurkan sejumlah kristal ke dalam sirup. Penambahan Kristal ini berfungsi sebagai inisiator agar terbentuk agregasi kristal. Sekali kristal terbentuk, kristal campur yang dihasilkan dan larutan induk (mother liquor) diputar di dalam alat sentrifugasi untuk memisahkan keduanya, bisa diumpamakan seperti pada proses mencuci dengan menggunakan pengering berputar.

Kristal-kristal tersebut kemudian dikeringkan dengan udara panas sebelum disimpan.Larutan induk hasil pemisahan dengan sentrifugasi masih mengandung sejumlah gula sehingga biasanya kristalisasi diulang beberapa kali. Sayangnya, materi-materi non gula yang ada di dalamnya dapat menghambat kristalisasi. Hal ini terutama terjadi karena keberadaan gula-gula lain seperti glukosa dan fruktosa yang merupakan hasil pecahan sukrosa. Olah karena itu, tahapan-tahapan berikutnya menjadi semakin sulit, sampai kemudian sampai pada suatu tahap di mana kristalisasi tidak mungkin lagi dilanjutkan.

Dalam sebuah pabrik pengolahan gula kasar(raw sugar) umumnya dilakukan tiga proses pendidihan. Pertama atau pendidihan “A” akan menghasilkan gula terbaik yang siap disimpan. Pendidihan “B” membutuhkan waktu yang lebih lama dan waktu tinggal di dalam panci pengkristal juga lebih lama hingga ukuran kristal yang dinginkan terbentuk. Beberapa pabrik melakukan pencairan ulang untuk gula B yang selanjutnya digunakan sebagai umpan untuk pendidihan A, pabrik yang lain menggunakan kristal sebagai umpan untuk pendidihan A dan pabrik yang lainnya menggunakan cara mencampur gula A dan B untuk dijual. Pendidihan “C” membutuhkan waktu secara proporsional lebih lama daripada pendidihan B dan juga membutuhkan waktu yang lebih lama untuk terbentuk kristal. Gula yang dihasilkan biasanya digunakan sebagai umpan untuk pendidhan B dan sisanya dicairkan lagi.

Sebagai tambahan, karena gula dalam jus tidak dapat diekstrak semuanya, maka terbuatlah produk samping (byproduct) yang manis disebut molase. Belakangan ini molase dari tebu di olah menjadi bahan energi alternatif dengan meningkatkan kandungan etanol sampai 99,5%.

Gula kasar yang dihasilkan akan membentuk gunungan coklat lengket selama penyimpanan dan terlihat lebih menyerupai gula coklat lunak yang sering dijumpai di dapur-dapur rumah tangga. Gula ini sebenarnya sudah dapat digunakan, tetapi karena kotor dalam penyimpanan dan memiliki rasa yang berbeda maka gula ini biasanya tidak diinginkan orang. Oleh karena itu gula kasar biasanya dimurnikan lebih lanjut ketika sampai di negara pengguna.  Gula seperti ini yang dinamakan raw sugar. Gula ini merupakan intermediet untuk dilakukan proses lebih lanjut. Raw sugar ini merupakan bahan baku yang sering digunakan oleh pabrik gula kristal putih dan industri  gula rafinasi. Gula kasar ini masih diimpor oleh PT Jawamanis Rafinasi dari negara lain karena di dalam negeri sulit menghasilkan gula kasar. Produksi gula dalam negeri langsung menghasilkan gula kristal putih yang kualitasnya lebih baik daripada gula kasar. Tetapi harganya tidak ekonomis untuk dipakai dalam pembuatan gula rafinasi.

Gula selain dikonsumsi langsung juga digunakan sebagai bahan baku untuk industri makanan. Pada saat ini kebanyakan pabrik gula di Indonesia hanya mampu menghasilkan gula kualitas GKP (gula kristal putih) yang dikonsumsi langsung. Gula ini masih belum memenuhi syarat untuk digunakan sebagai bahan baku industri makanan. Untuk itu industri makanan membutuhkan kualitas gula yang lebih baik yang diperoleh dari gula rafinasi. Kata rafinasi diambil dari kata refinery artinya menyuling, menyaring, membersihkan. Jadi bisa dikatakan bahwa gula rafinasi adalah gula yang mempunyai kualitas kemurnian yang tinggi.

Proses Pembuatan Gula Rafinasi

Proses rafinasi yang digunakan dalam pabrik gula rafinasi bervariasi tergantung pada bahan yang diolah produk yang dikehendaki dan pertimbangan lain sesuai kondisi lokal. Namun demikian secara garis besar dapat diuraikan menjadi stasiun sebagai berikut . Tahap pertama pemurnian gula yang masih kasar adalah pelunakan dan pembersihan lapisan cairan induk yang melapisi permukaan kristal dengan proses yang dinamakan dengan afinasi. Tujuan afinasi adalah mencuci kristal GKM (raw sugar) agar lapisan molases yang melapisi kristal berkurang sehingga warnanya semakin ringan atau warna ICUMSA lebih kecil. Pencucian dilakukan dalam mesin sentrifuga yaitu setelah GKM dicampur dengan sirup menjadi magma. Penurunan warna yang dicapai pada stasiun ini berkisar 30-50 %. Kristal yang telah dicuci dilebur dengan mencampur dengan air atau sweet water menghasilkan leburan(liquor) dengan brix sekitar 65.

Gula kasar dicampur dengan sirup kental(konsentrat) hangat dengan kemurnian sedikit lebih tinggi dibandingkan lapisan sirup sehingga tidak akan melarutkan kristal, tetapi hanya sekeliling cairan(coklat). Campuran hasil(magma) di-sentrifugasi untuk memisahkan kristal dari sirup sehingga kotoran dapat dipisahkan dari gula dan dihasilkan kristal yang siap untuk dilarutkan sebelum proses karbonatasi.

Cairan yang dihasilkan dari pelarutan kristal yang telah dicuci mengandung berbagai zat warna, partikel-partikel halus, gum dan resin dan substansi bukan gula lainnya. Bahan-bahan ini semua dikeluarkan dari proses.

Gambar: Proses afinasi gula rafinasi

Sumber: slide kuliah kimia & masyarakat, Arimulyo Nugroho(2009)

Tahap selanjutnya adalah proses klarifikasi. Pengoperasian unit ini bertujuan untuk membuang semaksimal mungkin pengotor non sugar yang ada dalam leburan(melt liquor). Ada dua pilihan teknologi yaitu fosflotasi dan karbonatasi, keduanya banyak dipakai, fosflotasi pada umumnya dan beberapa di Asia sedangkan selebihnya menggunakan teknologi karbonatasi, termasuk pabrik rafinasi di Indonesia.

Pada proses ini digunakan asam fosfat dan kalsium hidroksida yang akan membentuk gumpalan (primer) kalsium fosfat, reaksi ini berlangsung di reaktor. Penambahan flokulan(anion) sebelum tangki aerator dilakukan untuk membantu pembentukan gumpalan sekunder yang terbentuk dari gumpalan-gumpalan primer yang terikat oleh rantai molekul flokulan. Pembentukan gumpalan sekunder dapat menjerap berbagai pengotor : zat warna, zat anorganik, partikel yang melayang dan lain-lain. Untuk memisahkan gumpalan tersebut oleh karena dalam media liquor yang kental(brix: 65-70) maka gumpalan tidak diendapkan melainkan diambangkan. Proses pengambangan berlangsung dengan bantuan partikel udara yang dibangkitkan dalam aerator, proses pengambangan terjadi pada clarifier. Pada clarifier ini juga pemisahan gumpalan yang mengambang(scum) terjadi, yaitu dengan sekrap yang berputar pada permukaan clarifier dan menyingkirkan scum ke kanal yang dipasang pada sekeliling clarifier.Tahap pertama pengolahan cairan(liquor) gula berikutnya bertujuan untuk membersihkan cairan dari berbagai padatan yang menyebabkan cairan gula keruh. Pada tahap ini beberapa komponen warna juga akan ikut hilang.

Karbonatasi dapat diperoleh dengan menambahkan kapur/lime ke dalam cairan dan mengalirkan gelembung gas karbondioksida ke dalam campuran tersebut. Gas karbondioksida ini akan bereaksi dengan kapur membentuk partikel-partikel kristal halus berupa kalsium karbonat yang menggabungkan berbagai padatan supaya mudah untuk dipisahkan. Supaya gabungan-gabungan padatan tersebut stabil, perlu dilakukan pengawasan yang ketat terhadap kondisi-kondisi reaksi. Gumpalan yang terbentuk tersebut akan mengumpulkan sebanyak mungkin materi-materi non gula, sehingga dengan menyaring kapur keluar maka substansi-substansi non gula ini dapat juga ikut dikeluarkan. Setelah proses ini dilakukan, cairan gula siap untuk proses selanjutnya berupa penghilangan warna.

Selain karbonatasi, teknik yang lain berupa fosfatasi. Secara kimiawi teknik ini sama dengan karbonatasi tetapi yang terjadi adalah pembentukan fosfat dan bukan karbonat. Fosfatasi merupakan proses yang sedikit lebih kompleks, dan dapat dicapai dengan menambahkan asam fosfat ke cairan setelah liming seperti yang sudah dijelaskan di atas.

Gambar: Proses karbonatasi gula rafinasi

Sumber: slide kuliah kimia & masyarakat, Arimulyo Nugroho(2009)

Tahap selanjutnya adalah penghilangan warna. Untuk menghilangkan zat warna dapat dilakukan dengan beberapa cara diantaranya  dengan granula karbon aktif. Kandungan karbon aktif sekitar 60% dan dicampur dengan 5% MgO untuk mencegah turunnya pH. Karbon aktif ini dapat digunakan selama 3-6 minggu tergantung dari kualitas dan jumlah bahan yang masuk.

Kemampuan karbon aktif dalam mereduksi zat warna sangat tinggi, namun bahan ini tidak mampu menghilangkan zat anorganik yang terlarut. Selain itu digunakan juga bone char. Bahan ini terdiri dari campuran 90 % kalsium fosfat dan 10 % karbon yang dibuat dari tulang-tulang binatang ternak dipanaskan pada suhu 700 oC. Bone char dapat digunakan selama 4-5 hari kemudian di regenerasi kembali. Meskipun kemampuan mereduksi zat warna tidak sebaik karbon aktif namun mampu mereduksi kotoran zat anorganik.

Bisa juga untuk menghilangkan warna ini digunakan resin penukar ion(ion- exchange resin). Bahan ini mudah diregenerasi dan dalam penggunaannya mempunyai kapasitas lebih besar dibandingakan dengan karbon aktif maupun bone char.  Selain itu penggunaan air juga lebih efisien.

Ada dua jenis resin yang digunakan dalam rafinasi yaitu resin anion yang berfungsi mereduksi warna dan resin kation untuk menghilangkan senyawaan anorganik. Penggunaan resin senyawa akrilik lebih tahan dari resin stiren, namun resin akrilik kurang efektif dibanding resin stiren. Oleh sebab itu dalam proses dekolorisasi dianjurkan untuk menggunakan gabungan dua jenis resin ini secara seri, pertama sirup dilewatkan resin akrilik terlebih dahulu kemudian baru dilewatkan resin stiren. Pada umumnya stasiun dekolorisasi menghasilkan liquor dengan warna di bawah 300 IU sehingga dengan bahan tersebut dapat diproduksi gula rafinasi lebih rendah dari 45 IU.

Gambar: Proses penghilangan warna gula rafinasi

Sumber: slide kuliah kimia & masyarakat, Arimulyo Nugroho(2009)

Dalam proses rafinasi terdapat beberapa macam zat warna yang terbawa atau terbentuk  yaitu senyawaan fenolik. Senyawaan ini terdapat dalam tebu yang terbentuk dari hasil reaksi enzimatik flavonoid dan asam sinamat. Selain itu juga dihasilkan senyawa Melanoidins. Warna senyawa ini umumnya hitam, terbentuk dari reaksi antara gula reduksi dengan asam amino(Reaksi Maillard), terbentuk dalam proses. Senyawa karamel terbentuk dalam proses bila sukrosa mengalami pemanasan berlebihan sehingga terbentuk senyawaan yang berwarna. Warna yang dihasilkan bisa kuning, coklat atau hitam tergantung dari tingkatan reaksi selama pemanasan. Terakhir yang dihasilkan pada proses rafinasi adalah produk degdradasi gula invert. Meskipun kandungan glukosa dan fruktosa dalam proses rafinasi sangat kecil, namun senyawa ini mudah rusak oleh pemanasan terutama pada pH tinggi akan membentuk senyawaan polimer berwarna coklat yaitu 5-(hydroksimetil)-2-furaldehid.

Bahan utama kristalisasi adalah liquor yang sudah melewati tahap dekolorisasi. Liquor tersebut kemurniannya tinggi sehingga teknik kristalisasi berbeda dengan kristalisasi yang lainnya. Kristalisasi (evapocrystalisation) dilakukan di bejana vakum(65 cm Hg) dengan penguapan liquor pada suhu sekitar 70-80 0C sampai mencapai supersaturasi tertentu. Pada kondisi tersebut dimasukkan bibit kristal secara hati-hati sehingga inti kristal akan tumbuh mencapai ukuran yang dikehendaki tanpa menumbuhkan kristal baru. Campuran kristal sukrosa dengan liquor disebut masakan. Pemisahan kristal dilakukan dengan cara memutar masakan dalam mesin sentrifugal menghasilkan kristal (gula A) dan sirup A. Selanjutnya sirup A dimasak seperti yang dilakukan sebelumnya menghasilkan gula B dan sirup B. Demikian seterusnya sehingga secara berjenjang menghasilkan gula A, B dan C yang masuk dalam katagori gula rafinasi.

Proses terakhir adalah proses pengeringan gula produk. Sejumlah air diuapkan di dalam panci sampai pada keadaan yang tepat untuk tumbuhnya kristal gula. Sejumlah bubuk gula ditambahkan ke dalam cairan untuk mengawali/memicu pembentukan kristal. Ketika kristal sudah tumbuh campuran dari kristal-kristal dan cairan induk yang dihasilkan diputar dalam sentrifugasi untuk memisahkan keduanya. Proses ini dapat diumpamakan dengan tahap pengeringan pakaian dalam mesin cuci yang berputar. Kristal-kristal tersebut kemudian dikeringkan dengan udara panas sebelum dikemas dan/ atau disimpan siap untuk didistribusikan.

Untuk gula produk dibuat dua jalur dengan tujuan agar dapat diproduksi dua macam produk misal GKR dan GKP pada waktu yang bersamaan. Pembuatan dua jalur dimulai dari stasiun sentrifugal, pengering gula penimbangan dan pengemasan.

Gambar: Proses pengeringan warna gula rafinasi

Sumber: slide kuliah kimia & masyarakat, Arimulyo Nugroho(2009)

Produk dikemas dalam kantong polipropilen dengan linier, dengan berat gula 50 kg setiap kantong. Gula ditampung dalam sugar bin kapasitas 150 ton.

Sebagai standarisasi proses pembuatan gula rafinasi maka  lembaga Standar Nasional Indonesia(SNI) mengeluarkan standar tertentu agar dipenuhi oleh setiap industri pembuatan gula rafinasi. Berikut adalah persyaratan dari SNI.

Gambar: Proses pengemasan gula rafinasi

Sumber: slide kuliah kimia & masyarakat, Arimulyo Nugroho(2009)

Tabel  Persyaratan SNI Gula Rafinasi

Sumber: http://www.risvank.com

Evaluasi Kuliah

Salah satu hal yang membuat saya antusias pada kuliah kimia dan masyarakat pada minggu lalu adalah kedatangan tamu yang sangat ditunggu-tunggu yaitu Arimulyo Nugroho atau lebih dikenal dengan nama Mas Oho alumni kimia ITB. Mas Oho adalah sosok yang sangat  dinanti-nanti meskipun sebenarya saya juga tidak tahu sosok seperti apa yang akan datang pada kesempatan minggu ini, saya hanya mendengar bahwa Mas Oho adalah alumni kimia yang bekerja sebagai sales marketing pada salah satu peruasahaan gula rafinasi. Buat saya itu merupakan suatu anomali bahwa orang yang mempunyai latar belakang kimia, belum tentu bekerja sesuai dengan bidang keahliannya tetapi jauh menyebrang ke bidang yang sama sekali berbeda dengan ada yang ada pada perkuliahan yaitu bidang ekonomi.

Buat saya itu merupakan hal yang sangat menarik dan saya ingin tahu apa rumusnya.  Saya melihat bahwa latar belakang Mas Oho sebagai wakil kahim Amisca adalah kuncinya, ternyata  aktif di himpunan bukan hanya kumpul-kumpul tidak jelas seperti yang sebelumnya saya pikirkan. Aktif di  himpunan kata Mas Oho ternyata bisa melatih komunikasi bagaimana berbicara di depan publik, sebagai ajang aktualisasai diri  dan lain sebagainya. Pokonya menurut Mas Oho aktif di himpunan itu mempunyai manfaat yang sangat besar dan manfaatnya baru di rasakan ketika kita sudah terjun di dunia kerja.

Hal itu saya cenderung setuju juga karena yang saya rasakan ketika Mas Oho berbicara di depan kami ternyata kemampuan dalam berbicaranya cukup baik, beliau dapat menguasai masa  dan merasa bahwa audiens yang ada di depannya adalah temannya. Jadi saya sebagai peserta kuliah merasa tidak canggung lagi berhadapan dengan beliau. Mungkin karena kemampuannya memperlakukan lawan bicaranya tanpa melihat status maka beliau menjadi seorang sales yang sangat sukses.

Saya mendapat banyak manfaat dari kuliah ini diantaranya dalam hal proses pembuatan  gula rafinasi sampai masalah  menjadi seorang sales yang handal. Beliau menginspirasi saya bahwa  dengan latar belakang keilmuan kita adalah sebagai seorang mahasiswa kimia ternyata kita sudah tepat untuk menghadapi dunia kerja.

Mas Oho yang ketika lulus bekerja sebagai seorang quality control dan R&D ternyata menjadikan beliau tahu tentang seluk beluk proses yang ada pada industri gula rafinasi. Dengan kemampuan seperti itu beliau menjadi tahu tentang bagaimana memperlakukan pelanggan karena sudah tahu tentang barang yang akan dijualnya. Jadi pelanggan tidak merasa dirugikan  karena apa yang dibeIi sesuai dengan kualitasnya.

Hal itu memberikan hikmah buat saya tentang bagaimana menghadapi kuliah sekarang ini. Di dalam kuliah tidak semua mata kuliah menarik buat saya, tapi mau tidak mau saya harus ikut dan lulus dengan nilai yang sangat memuaskan. Contoh saja waktu semester lima saya belajar kimia kuantum. Pertamakali mempelajari  pelajaran seperti itu, saya seperti orang bodoh tidak tahu apa-apa   dan tidak tahu harus menyelesaikan dengan cara seperti apa. Hal itu memang cukup sulit buat saya karena rumus-rumusnya banyak dan maksud dari rumus itu  saya kurang tahu apa maksudnya.

Mugkin saja karena perasaan saya negative thinking tentang kimia kuantum, karena sudah ada ketetepan hati untuk melakukan tugas akhir biokimia maka saya sulit untuk mepelajarinya karena tidak sesuai dengan keinginan saya.

Tapi saya rasa, saya harus  menyingkirkan paradigma seperti itu saya harus grow up dan tetep survive apapun bidangnya. Saya berpendapat bahwa ilmu yang saya peroleh itu akan bermanfaat pada suatu saat nanti walaupun sebenarnya tidak berkaitan dengan interest saya. Suatu saat matakuliah seperti kimia kuantum pasti memberikan manfaat ketika kita berhadapan di dunia kerja. Walupun tidak secara langsung dunia kerja tidak memerlukan rumus-rumus dalam kimia kuantum tetapi  kegigihan kita untuk bagaimana mempelajari hal-hal yang baru, bertahan dengan sesuatu yang sama sekali tidak suka, membalikan paradigma yang salah dan lain-lain itu adalah sesuatu yang bermanfaat pada suatu saat nanti.

Di dunia kerja kata Mas Oho kompleksitasya jauh-jauh berbeda dibandingkan dengan perkuliahan. Makanya kita harus siap dengan hal-hal seperti itu. Satu hal lagi yang saya peroleh dari  Mas Oho  yaitu di dunia kerja tidak ada namanya kesalahan semuanya harus dilakukan dengan benar dan tidak boleh salah, berbeda  dengan perkuliahan yang masih ada pengampunan. Jadi kita harus tetap siap walaupun level kita harus turun sampai ke dasar  karena akibat kesalahan kita. Kita harus siap. Terima kasih Mas Oho.

Daftar Pustaka

  1. Sumber literatur pembutan gula rafinasi disarikan dari http://www.sucrose.com/(tanggal akses 13 Maret 2009)
  2. Sumber literature pembuatan gula kasar(raw sugar) disarikan dari http://smk3ae.wordpress.com/education/ (tanggal akses 19 Maret 2009)
  3. http://www.risvank.com(tanggal akses 19 Maret 2009)
  4. Slide kuliah kimia & masyarakat, Arimulyo Nugroho(2009)
  5. http://berita-iptek.blogspot.com/(tanggal akses 19 Maret 2009)
  6. Kingsman Reports(data konsumsi dan produksi gula dunia)