Pembuatan Alat Diagnosis Virus Dengue Murah dengan Menggunakan Epitop Protein Dengue yang Spesifik Terhadap Immunoglobulin G (IgG) Berbasiskan Imunokromatografi dan Imunofluresensi

Tak terasa kuliah kimia dan  masyarakat sudah memasuki minggu ke empat. Waktu terasa sangat cepat sekali berlalu eskipun dalam perjalanannya berbagai kerikil tajam silih berganti menghalangi penulis untuk tetap melangkah ke depan. Berbagai hambatan yang silih berganti sempat membuat penulis shock dengan apa yang terjadi pada semester ini tetapi penulis yakin bahwa hal itu akan menjadi masa lalu pada akhirnya. Tugas-tugas perkuliahan yang silih bergantI, UTS, PR dan tugas resume kulih kimia dan masyarakat cukup menyita perhatian penulis. Tetapi penulis yakin ini pun akan menjadi massa lalu pada akhirnya.

Semoga saja semua apa yang telah dilalui oleh penulis akan menjadi pelajaran yang berharga untuk melaju ke level yang lebih tinggi. Level yang tidak semua orang berkesempatan untuk mencobanya. Semoga saja akan menjadi happy ending pada akhirnya.

Kuliah kimia masyarakat pada hari Jumat tanggal 20 Maret 2009 yang lalu diisi oleh seorang yang tidak biasanya dari kuliah-kuliah sebelumnya. Sebelumnya dosen tamu menampilkan pembicara seorang pria namun pada kesempatan itu kuliah kimia dan masyarakat menampilkan sosok seorang wanita yaitu Ibu Neli.

Ibu Neli adalah seorang direktur sebuah perusahaan yang bergerak di bidang pengadaan alat-alat diagnosis. Dalam hal ini beliau menjadi agen alat-salat diagnosi yang berasal dari luar negeri khususnya yang berasal dari Amerika. Alat-alat diagnosis tersebut berasal dari perusahaan-perusahaan terkenal seperti Biorad (USA), Promega dan lain lain.

Alat-alat diagnosis harus diimpor dari luar negeri karena bangsa Indonesia belum mampu memproduksi alat-alat seperti itu. Oleh karena itu Bu Neli bersama perusahaannya yaitu Diastika menjadi agen untuk pengadaan alat-alat diagnosis di Indonesia. Usaha Beliau mencakup seluruh wilayah Indonesia dan target pasarnya adalah laboratorium klinis, laboratorium penelitian, laboratorium farmasi, institusi swasta dan pemerintah yang bergerak dalam bidang penelitian dan universitas.

Usaha  Beliau sekarang sangat menjanjikan karena sekarang ini alat-alat seperti itu diperlukan seiring kemajuan dalam bidang bioteknologi dan kedokteran. Selain itu juga  prospek pasar yang menjadi sasaran pun cukup mudah yaitu laboratorium penelitian dan rumah sakit. Hal ini berbeda dengan-usaha lain yang mempunyai pasar heterogen. Jadi dalam hal ini kepercayaan merupkan sesuatu yang patut dikedepankan untuk merebut pasar.

Dalam kuliahnnya beliau membicarakan tentang penggunaan HPLC dalam mendiagnosis penyakit  thalasemia dan diabetes mellitus. Dalam kuliahnya beliau mengedepankan sisi pengguanan  alat diagnosis seperti HPLC, spektrofotometri dan lain-lain. Oleh karena itu dalam resume ini penulis lebih mengedepankan tentang penggunaan alat diagnosis untuk mengobati penyakit. Khusus untuk thalasemia dan diabetes mellitus penulis akan membicarakan sekilas saja tidak akan mendalam.

Dalam resume ini penulis akan membicarakan bagaimana seharusnya kita  membuat alat diagnosis sendiri dan tidak perlu mengimpor dari negara lain. Penulis akan berbiacara mengenai tahapan-tahapa untuk membuat alat diagnosis yang baru khususnya alat diagnosis untuk mendeteksi adanya virus dengue.

Demam dengue (dengue fever, DF) dan beberapa manifestasinya, yaitu Dengue Hemmorhagic Fever (DHF) dan Dengue Shock Syndrome (DSS), disebabkan oleh infeksi virus dengue yang disebarkan melalui vektor nyamuk Aedes aegepty (Henchal, 1990) yang termasuk kedalam keluarga flaviviridae. Virus ini termasuk virus arbovirus yaitu ditransmisikan oleh vektor lain yaitu nyamuk.  Virus dengue memiliki empat jenis serotipe, yaitu serotipe 1, 2, 3 dan 4 dengan diantara ke empat serotipe tersebut memiliki hubungan dekat dalam hal perbedaan antigennya.

Infeksi yang disebabkan oleh virus dengue biasanya tidak dapat di lihat secara klinis ataupun hasil klinis menunjukkan sakit febrille yang tidak spesifik, DF atau DHF. Adanya kerusakan plasma darah yang parah dapat mengakibatkan DHF dimana angka kematian untuk pasien tanpa pengobatan akan mencapai 40-50 % (AnandaRao et al., 2005).

Diagnosis awal terhadap infeksi virus dengue yang diikuti dengan penanganan yang intensif dan juga penanganan gejala-gejala DF melalui penggantian cairan tubuh merupakan kunci utama dalam menangani infeksi dengue.

Map: World distribution of dengue viruses and their mosquito vector, Aedes aegypti, in 2005

Gambar distriribusi virus dengue dan vektor Aedes aegypti pada tahun 2005

Sumber: http://www.cdc.gov

Diagnosis terhadap infeksi dengue dapat dideteksi melalui beberapa metoda, yaitu identifikasi virus dengue, antigen-pengkode virus, genomik RNA virus, dan juga produksi antibodi yang di induksi oleh virus. Identifikasi virus dengue melalui proses isolasi virus tersebut dapat memakan waktu beberapa hari dan juga tidak selalu berhasil mengingat sedikitnya jumlah virus yang mampu bertahan hidup pada sampel plasma darah pasien. Antigen viral dapat dideteksi melalui immunohistochemistry atau immunofluorescence. Akan tetapi, karena komlpeksnya proses dan juga mahalnya biaya pengujian ini menyebabkan pengujian melalui metoda immunohistochemistry jarang digunakan.

RNA viral dapat dideteksi menggunakan reverse transcription and polymerase chain reaction (RTPCR), akan tetapi seperti diagnosis yang lainnya, proses RTPCR mambutuhkan alat yang sangat rumit dan juga mahal. Sehingga dari beberapa metode identifikasi infeksi yang disebabkan oleh virus dengue, maka diperlukan metode yang lebih sederhana, cepat dan juga murah untuk proses identifikasi infeksi yang disebabkan oleh virus dengue.

Beberapa jenis alat diagnosis dengue, dalam berbagai format, dapat ditemukan di pasaran pada saat ini. Kebanyakan dari alat diagnosis tersebut bergantung pada penggunaan antigen virus secara keseluruhan (diproduksi secara kultur jaringan) untuk mendeteksi antibodi anti-gen yang terdapat pada sera pasien, sehingga sangat berhubungan sekali dengan resiko yang ditimbulkan bawaannya.

Diantara alat diagnosis dengue, terdapat satu alat diagnosa yang telah mengganti antigen virus keseluruhan dengan protein envelope dengue yang di ekspresikan pada serangga yang dapat menghilangkan resiko bawaan tersebut. Akan tetapi alat-alat diagnosis dengue tersebut memiliki nilai ekonomis yang tinggi dikarenakan proses produksi antigen, sehingga pembuatan alat-alat diagnosis tersebut tidak dapat terjangkau untuk negara-negara berkembang.

Dari permasalahan diatas, maka diperlukan adanya suatu metoda identifikasi terhadap infeksi yang disebabkan oleh virus dengue yang mudah, murah dan juga aman yang menggabungkan antara sensitifitas dan spesifisitas.

Kebetulan penulis sedikit tahu mengenai proyek ini karena dalam tugas proyek khusus seester ini temanya tidak jauh berbeda. Dalam tugas proyek khusus penulis mengambil tema kloning pengkode epitop immunoglobulin (IgG) virus dengue. Tema proyek khusus penulis ini cukup menarik karena nantinya direncanakan untuk membuat alat diagnosis virus dengue yang menyebabkan penyakit demam berdarah.

Mean Annual Number of DHF Cases
Thailand, Indonesia and Vietnam, by Decade

* Provisional data through 1998

Gambar: grafik jumlah kasus demam berdarah dengue di Indonesia, Thailand dan Vietnam

Sumber: http://www.cdc.gov

Sementara kita tahu kasus demam berdarah di Indonesia terus meningkat dalam beberapa dekade. Kasus demam berdarah hampir setiap tahun terjadi di Indonesia khususnya pada musim hujan. Alat pendeteksi demam berdarah ini sudah ada tetapi cukup mahal. Apalagi kasusnya terjadi di beberapa negara tropis seperti Indonesia yaitu negara berkembang.

Kita cukup kesulitan untuk mendatangkan alat-alat diagnosis yang sudah ada seperti ELISA karena harganya memang sangat mahal sehingga tidak terjangkau. Saya mungkin berpikir kenapa kita harus mengimpor alat- alat diagnosis seperti itu dari negara lain  sedangkan wabahnya kita yang mengalami bukan negara subtropis seperti  Amerika. Kasus-kasus demam berdarah misalnya, penyakit ini mewabah di sekitar negara tropis  yang disebabkan oleh vektor yaitu nyamuk Aedes aegepti. Nyamuk ini membawa virus dengue dan menularkannya ke manusia lewat gigitan nyamuk. Jadi virus dengue adalah arbovirus yang ditransmisikan oleh vektor nyamuk.

Kasusnya mungkin serupa dengan kasus NAMRU yang diblokir oleh Menteri kesehatan. Negara-negara maju seperti Amerika lebih pintar daripada kita. Mereka meneliti vektor-vektor penyakit yang ada di Indonesia seperti virus H5N1, dengue dan lain lain. Kemudian sampel tersebut mereka ambil dan dibawa kenegaranya untuk diteliti. Setelah berhasil dengan penemuan obat-obatan dan berbagai alat diagnosis maka mereka jual alat-alat dan obat tersebut  ke Indonesia. Jadi kita celaka dua kali, seperti telah jatuh tertimpa tangga, sudah sial tambah sial lagi. Maka sekarang kita tergantung dengan negara-negara seperti Amerika karena mereka lebih maju daripada kita.

Oleh karena itu kita sebagai calon ilmuan harus lebih pintar. Penyakit yang ada di Indonesia harus diteliti oleh orang Indonesia khususnya calon-calon ilmuan dari kimia ITB. Jangan sampai kita tergantung terus pada negara lain.

Penulis berpikir ini adalah perang pada zaman sekarang. Perang sekarang lebih berbahaya daripada perang dunia I atau perang dunia II. Pada zaman tersebut yang dinamakan  perang adalah saring tos-tosan senjata, tembak menembak dan akahirnya bencananya langsung dapat dirasakan. Tetapi yang dinamakan perang pada zaman sekarang adalah ketergantungan kita pada Negara lain karena lemahnya ilmu pengetahuan dan teknologi.

Oleh karena itu saatnya kita mulai memproduksi ilmu pengetahuan dan teknologi sendiri dan mengembangkan alat diagnosis sendiri. Alat diagnosis yang akan penulis buat adalah pendeteksi virus dengue penyebab demam berdarah.

Dari jurnal yang penulis peroleh misalnya dilaporkan ada beberapa daerah epitop dari virus dengue. Epitop adalah suatu daerah tertentu pada protein tempat penempelan antara antibodi yang dihasilkan pasien dengan bagian protein yang dihasilkan oleh virus dengue.  Dengan mengetahui daerah tersebut maka kita cukup merancang secara sintetis protein tersebut (epitop protein dengue) ke dalam sebuah material alat pendeteksi. Material yang telah mengandung epitop protein dengue tersebut misalkan saja akan berpendar (fluresensi) ketika kita teteskan serum darah pasien yang diduga terinfeksi dengue.

Jika memang alat tersebut berpendar berarti sudah terjadi ikatan antara antibodi yang pasien hasilkan dengan multioepitop protein dengue. Kalau kita misalkan antibodi yang spesifik kita hasilkan untuk melawan serangan dengue berarti kita sudah terinfeksi virus dengue. Dan kalau misalkan responnya negatif berarti  kita tidak terinfeksi virus dengue.

Alat-alat seperti ini mirip seperti alat tes kehamilan yang dapat dilihat positif hamil tau tidaknya dengan melihat jumlah strip yang dihasilkan. Saya tidak tahu strip satu atau strip dua untuk mendeteksi hamil atau tidaknya karena saya tidak akan pernah hamil. Maaf kalau alasan ketidaktahuan saya itu tidak ilmiah.

Prinsip utama dari tes kehamilan adalah mendeteksi hormon spesifik yang dihasilkan ketika mengalami kehamilan. Hormon tersebut hanya akan dihasilkan kalau wanita itu hamil. Jadi kita dapat mengetahui seorang wanita itu hamil atau tidak dengan mengetes hormon tesebut.

Dengan landasan seperti itu kita juga bisa mengetes atau mendiagnosis penyakit-penyakit yang lainnya yang didasarkan pada hal-hal  speisfik yang dihasilkan. Maka kita dapat dengan mudah membuat alat diagnosis sendiri termasuk mendiagnosis dengue dengan cara mengetes antibodi yang dihasilkan.

Roadmap penelitaian yang akan penulis jalani ada beberapa tahapan. Tahap penelitian pertama diantaranya mengembangkan protein multiepitop dengue rekombinan yang dapat mendeteksi antibodi Immunoglobulin G (IgG) serta mengisolasi dan memurnikan protein multiepitop dengue rekombinan tersebut. Tahap kedua adalah memproduksi multiepitop protein dengue dalam skala yang lebih besar. Tahap ketiga adalah  adalah penelitian

Gambar: tes fluresensi antibodi

Sumber: http://www.cdc.gov

mengenai aplikasi terhadap multiepitop yang telah diteliti sebelumnya denga cara mengaplikasikan ke dalam sebuah material pendeteksi berbasis imunokromatografi dan atau imunofluresensi. Tahap keempat adalah mencari mitra kerja untuk bekerjasama mengembangkan alat diagnosis ini. Tahap kelima adalah membangun sebuah perusahaan seperti Promega, Biorad di Indonesia. Tahap  terakhir adalah kembali ke laboratorium untuk  meneliti alat pendiagnosis lainnya yang berguna untuk kesejahteraaan manusia. Semoga saja rencana penelitian penulis ini berhasil.

Tahap pertama penelitian adalah memepelajari multioepitop protein dengue yang spesisfik terhadap immunoglobulin G. Dari jurnal yang penulis peroleh ternyata multiepitop protein tersebut telah dipublikasikan diantaranya multiepitop protein yang spesifik terhadap IgG (r-DME-G).

R-DME-G protein (recombinant dengue multiepitope protein, specific to IgG) dapat digunakan sebagai alat diagnosis untuk merespon immunoglobin IgG yang dihasilkan saat virus dengue berada dalam tubuh pasien. Lokasi epitop pada poliprotein virus dengue dan urutannnya dapat dilihat pada gambar 1.

Dari hasil penelitian ternyata ada 15 epitop yang terdapat pada virus dengue, delapan dari E (envelope) protein, enam dari NSI dan satu dari NS3 (AnandaRao et al, 2005). Multiepitop ini memiliki 6 sampai 20 residu asam amino. Epitop setiap serotip virus dengue berbeda-beda, serotip dengue 1 terdapat pada epitop 9,  serotip 2 (epitop1-8 dan 10), serotip 4 (epitop 11-15) dan dari hasil penelitaian AnandaRao ternyata  serotip 3 belum didokumentasikan.

Gambar 1: lokasi epitop pada poliprotein virus dengue. Gambar ini merepresentasikan poliprotein virus dengue. Tanda asterisk menandakan epitop yang terdiri dari 1-15 dan tanda panah menyatakan jumlah asam amino yang terdapatpada epitop tersebut.

Sumber: (AnandaRao et al, 2005)

Setelah kita mengetahui multiepitop pada setiap serotip gen dengue yang dihasilkan. Selanjutnya kita harus menerjemahkannya ke dalam kode DNA. Sebagaimana kita tahu dalam dogma sentral itu ada tiga tahapan. Pertama dari kode genetik DNA yaitu basa guanine (G), timin (T), adenine (A) dan sitosin (C) disusun sedemikian rupa dengan susunan tertetu untuk mengkode protein yang disebut gen. Gen tersebut kemudian ditranskripsi ke dalam messenger RNA (mRNA) yang selanjutnya ditranslasi menjadi urutan protein.

Protein inilah yang selanjutnya dihasilkan oleh virus dengue dan menimbulkan respon antibodi kita khususnya immunoglobulin G. Setelah kita tahu mengenai urutan protein yang dihasilkan, kita bisa mensintesis kode genetik DNA tersebut. Perusahaan yang memberikan jasa pelayanan sintesis DNA yaitu diantaranya yang saya tahu itu adalah DNA 2.0 yang berada di Amerika. Indonesia belum bisa mensintesis sendiri oleh karena itu bisnis yang bergerak dalam bidang bioteknologi sangat prospektif dikembangkan di Indonesia.

Gen sintesis yang akan  dikloning  mengkode r-DME-G protein dan diprediksi mengkode sekitar 25 kDa rekombinan protein yang terdiri dari 15 epitop. Prediksi urutan asam amino pada r-DME-G protein dapat dilihat pada gambar 2A dan analisis model struktur r-DME-G protein dapat dilihat pada gambar 2B.

Gen sintetis epitop dengue ini kemudian dikloning atau ditempatkan dalam sebuah plasmid bakteri yang selanjutnya disebut vektor. Sedikit informasi saja bahwa setiap asam amino (protein adalah polimer dari asam amino) yang dihasilkan dikode oleh setiap tiga basa. Misalkan saja pada gambar diatas asam amino pertama disintesis adalah M (metionin) jadi urutan DNA sintesisnya adalah ATG (adenin-timin-guanin). Selanjutnya setiap asam amino dikode oleh tiga

Gambar 2 : Desain r-DME-G protein. (A) Urutan Asam amino dari r-DME-G protein pada gambar 1. Epitop asam amino ditulis dengan huruf normal dan rantai trigliseril ditulis dengan huruf tebal. Dalam tiga epitop tersebut residu karboksi terminal ditandai dengan asterik yaitu G dan merupakan bagian dari rantai trigliseril. Residu amino terminal 1-4 dan residu karboksi terminal 8 sampai dengan 6xHis tag yang digambarkan dengan huruf tebal adalah hasil pengkodean oleh urutan plasmid asal. (B) Visualisasi r-DME-G protein dengan menggunakan ViewerLite Software.

Sumber: (AnandaRao et al, 2005)

basa yang dikombinasi dengan khas sesuai dengan  asam amino yang dikode. Berikut adalah beberapa kode genetik dari epitop protein yang dihasilkan virus dengue.

ATGGGTGGTTCGGAGACCTTGGTTACCTTCAAAAATCCTCACGCAAAAAAGCAG

MetGlyGlySerGluThrLeuValThrPheLysAsnProHisAlaLysLysGln

GACGTGGTCGTGCTGGGTAGCGGCGGTGGCAACCTGCTGTTCACCGGTGGTGGC

AspValValValLeuGlySerGlyGlyGlyAsnLeuLeuPheThrGlyGlyGly

CCGTTCGGTGATAGCTATATCATTATCGGTGTG… dan seterusnya

ProPheGlyAspSerTyrIleIleIleGlyVal

Menariknya bioteknologi adalah kita bisa menguasasi kode-kode kehidupan. Saya pernah mendengar dari seorang ilmuan biokimia bahwa kalau kita sudah menguasai apa arti dari kode-kode genetik tersebut maka bahasa hiperbolanya berbunyi “Kita setidaknya telah mengerjakan sebagian pekerjaan Tuhan”.

Karena yang membedakan manusia dengan organisme lain seperti monyet dan cacing terletak pada kondisi kode-kode seperti ini. Kode genetik yang berbeda akan menghasilkan protein yang berbeda pula, sehingga jalur metabolismenya pun berbeda dan secara fisik akan berbeda juga.

Jadi Tuhan hanya mempunyai empat kode (A,T,G,C) untuk membuat suatu organisme hidup. Tuhan hanya mengkombinasikan ketiga basa tersebuat untuk menyusun makhluk hidup.

Ternyata ilmu tentang alam (biologi) lebih hebat daripada ilmu manapun termasuk bidang teknologi informasi yang sering dibanggakan oleh mahasiswa informatika. Komputer hanya mempunyai dua kode yaitu Yes dan No berbeda dengan kehidupan yaitu kombinasi antara A, T, G, dan C.

Lalu setelah kita tahu kombinsi dari kode genetik yang akan diproduksi untuk menghasilkan epitop protein dengue yang berasal dari kode genetik sintesis. Tahap selanjutnya adalah tahap sintesis protein dari kombinasi kode genetik tersebut.

Tahap sintesis protein adalah tahap yang sangat menyenangkan karena tahap ini adalah tahap yang paling santai bagi manuasia. Tetapi  tahap yang sebaliknya bagi bakteri seperti Escherichia coli yang dipakasa untuk mengekspresikan protein yang kita inginkan.

Dalam tahap ini bakteri adalah host untuk menghasilakan protein epitop dengue. Jadi kode genetik epitop dengue yang teklah kita sintesis sebelumnya dikloning ke dalam tubuh bakteri dengan menggunakan sebuah vektor ekspresi seperti plasmid pGEM-T dengan teknik DNA rekombinan. Jadi intinya kode genetik yang telah kita sintesis ditransformasi ke dalam bakteri, dan bakteri tersebut dipaksa untuk memproduksi protein dengue yang kita inginkan.

Alasan kenapa digunakan bakteri untuk menghasilkan protein adalah karena siklus replikasi bakteri yang lebih singkat. Bakteri dapat membelah diri menjadi dua dalam waktu yang singkat misalkan saja untuk kasus E. coli , bakteri ini membelah setiap 20 menit sekali. Jadi protein yang dihasilkan pun akan banyak dan lebih cepat.

Selanjutnya protein epitop dengue akan dihasilkan oleh bakteri misalnya Escherichia coli.  Proses sintesis protein ini dilakukan oleh bakteri dalam sebuah bioreaktor. Jadi tugas kita cukup mudah kita hanya menyediakan nutrisi buat bakteri, oksigen, cahaya dan kondisi fisiko-kimia yang mendukung.

Inilah yang dianaman bioteknologi. Bioteknologi adalah teknologi yang berasal dari alam karena alam menginspirasi kita. Kita tidak harus susah-susah mensintesis suatu senyawa dengan sintesis kimia yang tidak gampang, mari kita serahkan sepenuhnya pada alam. Biarkan alam memberikannya buat kita, Itu adalah konsep pertama yang dipelajari dari bioteknologi.

Setelah kita memproduksi protein epitop protein dengue dengan menggunakan bioreaktor, tahap selanjutnya adalah mengaplikasikan protein tesebut sehingga membentuk sebuah plat material yang terbuat dari serangkaian protein epitop dengue. Untuk tahap pembuatan alat diagnosis dengan menggunakan suatu pelat yang mirip pelat KLT (kromatografi lapis tipis) ini penulis harus belajar banyak dari mata kuliah kimia material yang belum penulis ambil pada semester ini. Kalau misalkan penulis sudah mengambil kuliah kimia material, pada kesempatan lain penulis akan berbicara lebih banyak.

Namun pada intinya pembuatan pelat material yang berisi serangkaian epitop protein virus dengue ini berbasis teknik imunokromatogtrafi dan atau imunofluresensi. Prinsip dari teknik ini yaitu mengguanakan pelat yang akan berpendar seandainya ada antibodi yang spesifik terhadap dengue dalam serum darah pasien yang berikatan dengan protein yang berada pada pelat imunokromatografi atau imunofluresensi.

Namun bisa juga protein dengue yang diproduksi oleh bakteri dalam skala besar ini digunakan dalam bentuk cairan tetes. Artinya untuk mengetes adanya antibodi terhadap dengue dalam tubuh maka serum darah direaksikan dengan protein epitop dengue dan hasil positif dapat dilihat dari perubahan warna hasil reaksi antara protein epitop dengue dengan serum darah.

Jadi kesimpulannya kita juga bisa mengembangkan suatu alat diagnosis dengue yang sederhana, sepat, mudah, murah dan akurat dengan cara menggunakan protein epitop dengue berbasis imunokromatografi dan atau imunofluresensi.

Untuk sekarang memang kita cukup leluasa mengguankan bakteri untuk dimanfaatkan dalam kehidupan manusia seperti produksi obat, insulin dan sintesis protein. Kita jujur saja telah mengeksploitasi seluruh potensi  dari bakteri sampai bakteri itu mati.  Menurut Bu Marlia Singgih Wibowo (dosen Sekolah Farmasi ITB) akan ada ada masalah kalau kita terus menerus mengeksploitasi  bakteri. Mungkin saja menurut beliau suatu saat nanti akan ada perkumpulan pecinta bakteri mirip perkumpulan pecinta binatang. Jadi kita tidak bebas mengeksploitasi bakteri untuk dimanfaatkan karena akan diprotes oleh para pecinta bakteri.  Saya cukup tergelitik dengan peryataan Bu Marlia itu, apakah akan ada perkumpulan pecinta bakteri. Kalau memang ada sungguh merupakan perkumpulan yang sangat konyol. Mereka lebih suka membela bakteri daripada manusia.

Kasusnya sama seperti perkumpulan pecinta binatang. Mereka membela bintang yang dibunuh dalam percobaan. Satu hal yang tidak dimengerti oleh akal kita yang normal adalah mereka lebih suka mencintai selain manusia seperti binatang daripada mencintai sesamanya yang sedang terserang penyakit. Tujuan penggunaan binatang dalam percobaan itu bukan tidak ada tujuan melainkan untuk mengetes terlebih dahulu sehingga memberikan rasa aman sebelum diberikan kepada manusia. Mari kita bayangkan apakah kita tega menggunakan manusia sebagai kelinci percobaan.  Orang yang normal pasti mengatakan tidak.

Paragraf diatas merupakan selingan saja biar kening para pembaca tidak terlalu berkerut  karena penulis merasa tulisan resume pada kali ini cukup ilmiah dibandingkan dengan resume–resume  sebelumnya. Oleh karena itu selingan perlu disisipkan pada setiap bagian agar tidak terlalu ilmiah.

Selanjutnya penulis akan membahas masalah yang lebih serius yaitu mengenai kemandegan teknologi di Indonesia khususnya di ITB. Salah satu alasan menurut Bu Pingkan Aditiawati (wakil dekan SITH ITB) adalah karena mahasiswa-mahasiswa ITB kehilanggan inspirasi. Bu Pingkan berpendapat bahwa inspirasi yang hebat itu berasal dari alam. Misalkan saja penggunaan membran pada industri, semuanya itu terinspirasi dari kehebatan memebran sel yang selektif terhadap zat-zat yang masuk ke dalam sel. Dan sampai sekarang belum biasa dirancang sebuah membran sehebat membran sel.

Oleh karena itu untuk menghilangkan kemandegan inspirasi maka semenjak tahun 2008 seluruh mahasiswa  ITB  pada Tahap Persiaan Bersama (TPB) memperoleh  mata kuliah alam semesta yang merupakan bagian dari matakuliah biologi dasar. Hal tersebut dilakukan untuk menghilanngkan kemandegan inspirasi dalam mengembangkan teknologi.

Dengan perkembangan bioteknologi di Indonesia diharapkan nantinya produksi senyawa-senyawa obat seperti insulin buatan untuk mengobati penderita diabetes mellitus. Kadar glukosa dalam darah diatur dengan hormon yang dihasilkan di dalam pankreas, hormon ini dinamakan insulin. Insulin dalah hormon yang mengatur kadar glukosa dalam darah karena dapat merubah glukosa yang berlebih di dalam darah menjadi cadangan energi berupa glikogen. Kekurangan hormon ini menyebakan glukosa dalam darah tidak dapat disimpan sehingga terbuang begitu saja melalui urin. Sehingga hal tersebut akan mempengaruhi metabolisme sel yang lain seperti metabolisme protein dan metabolism lipid oleh karena itu akibat kekurangan insulin atau sel pankreas tidak dapat memproduksi sama sekali maka timbul penyakit yang dinamakan kencing manis atau diabetes melitus.

Diabetes mellitus ini ada beberapa tahap ada diabetes mellitus tipe satu dan dua. Diabetes tipe satu adalah tipe diabetes yang mempunyai ketergantungan tehadap insulin karena sel pankreas tidak bisa memproduksi hormon ini atau memproduksi dalam jumlah sangat sedikit. Biasanya penyakit ini mulai terjadi pada remaja sekitar usia 15 tahun. Oleh karena itu perlu adanya suntik insulin sampai empat kali sehari. Insulin yang dimasukan dalam tubuh harus dengan suntikan karena kalau secara oral dimakan maka hormon ini akan hancur dalam sistem pencernaan. Penyakit diabetes tipe satu ini termasuk penyakit autoimun karena sistem pertahanan tubuh merusak sel penghasil insulin yang disebut beta sel.

Sedangkan diabetes mellitus tipe dua tidak tergantung insulin artinya kadar glukosa dalam darahnya masih bisa dikontrol  karena masih memproduksi insulin. Oleh karena itu diet yang tepat sangat penting unttuk menjaga kondisi gula dalam darah. Biasanya penyakit diabetes tipe 2 terjadi pada manusia yang sudah berumur 45 tahun ke atas.

Salah satu perawatan yang sederhana untuk menjaga kadar glukosa dalam darah tetep normal adalah memakan makanan yang tidak mengandung glukosa, salah satu contoh diantaranya memakan buah-buahan. Buah-buahan sangat cocok sekali karena mengandung fruktosa yang sedikit berbeda metabolismenya dengan glukosa.

Selain itui perkembangan rekayasa genetika membuat kita lebih mudah untuk mendapatkan insulin. Sebelum rekayasa mulai berkembang pada waktu dulu orang-orang mendapatkan insulin dari sapi. Tetapi sekarang lebih mudah cukup kita memindahkan gen penghasil insulin ke dalam plasmid bakteri dengan teknik rekombinan DNA, dengan cara seperti itu sel bakteri dipaksa untuk mengkspresikan gen tersebut dalam bentuk hormon insulin. Salah satu alasan lagi kenapa  dilakukan ekspresi insulin pada bakteri karena bakteri lebih mudah berkembang biak berbeda sekali dengan sapi yang memerlukan waktu  beberapa tahun untuk tumbuh.

Evaluasi Kuliah

Kuliah kimia dan masyarakat pada  tanggal 20 Maret 2009 sungguh sangat spesial bagi penulis karena akhirnya ada juga dosen tamu seorang wanita. Apalagi yang datang pada kesempatan itu adalah Bu Neli seorang direktur sebuah perusahaan alat-alat diagnosis.

Saya berpikir kuliah dosen pada hari itu diisi oleh seorang dosen kimia ITB yaitu Dr. Lia Juliawati tetapi ternyata bukan. Wajah Bu Neli ini nampak dari kejauhan mirip seperti Bu Lia. Saya melihat dari warna kulit, bentuk muka dan posturnya itu sangat mirip sekali.

Bu Neli cukup memberikan nuansa yang berbeda pada waktu itu. Saya juga ikut terlarut di dalamnya. Kuliah yang memberikan banyak sekali pelajaran yang sangat berharga yaitu tentang bagaimana membuka usaha dari nol disamping pengetahuan tentang penyakit thalasemia dan diabetes mellitus.

Ilmu yang penulis dapat dari Bu Neli adalah nilai dari sebuah ketekunan, kerja keras, berjiwa besar dan juga berpikir positif. Itulah yang menjadi kunci Beliau dalam mengembangkan usahanya.

Seseorang akan menjadi manusia besar diawali oleh pikirannya. Apabila pikiran manusia hanya berpikir kecil maka manusia tersebut tidak akan pernah menjadi orang-orang yang besar. Sebaliknya apabila manusia berpikir suatu hal yang besar maka manusia tersebut akan menjadi orang-orang yang besar.

Dalam menghadapi pembangunan yang berkelanjutan yang perlu diperhatikan adalah manusia yang berkualitas terutama dalam pemikiran daripada kuantitas manusia yang bekerja dalam pembangunan. Kualitas dari manusia dapat dilihat dari pola pikirnya. Dapat dianalogikan untuk melihat gelas yang berisi setengah air. Apabila manusia melihat gelas tersebut adalah setengah kosong maka manusia tersebut orang yang pesimis. Sebaliknya apabila manusia melihat gelas tersebut adalah setengah isi maka manusia tersebut orang yang optimis.

Dengan pemikiran yang besar dapat membuat manusia menjadi visioner. Manusia visioner merupakan manusia yang bisa melakukan pencapaian-pencapaian besar. Manusia-manusia visioner dapat menjadi golongan creative minority. Creative minority merupakan sekumpulan manusia yang minoritas yang dapat melakukan suatu perubahan besar.

Dalam menjalani hidup, tentu saja kita sebagai manusia selalu ada masalah dan tantangan yang diberikan Tuhan. Apa yang Tuhan berikan itu pastilah untuk menguji kita sebagai hamba apakah tetap berada dijalan-Nya atau tidak. Setiap orang punya masalah tapi yang membedakan orang yang satu dengan yang lain adalah bagaimana orang tersebut me-manage dan menyikapi masalah yang dihadapi.

Secara sadar ataupun tidak, kita sering mengeluh dan berpikir negatif terhadap keadaan atau situasi yang kita alami. Berpikiran negatif kepada sesama manusia saja tidak baik, apalagi kalau kita sampai berpikiran negatif kepada Sang Pencipta.
Keadaan kita tidak akan berubah dari satu kondisi ke kondisi lain, kecuali dengan usaha kita sendiri. Memang semuanya hanya akan terjadi dengan takdir Tuhan, tetapi dalam menjadikan segala sesuatu itu, Tuhan menggunakan sebab. Selama kita belum mengenal hukum perubahan ini dengan baik, maka segala upaya untuk mengatasi rasa cemas atau agar terbebas dari kesusahan, tidak berguna. Kita tidak akan mampu terbebas dari rasa cemas kecuali jika kita sendiri bersikeras untuk mengatasi hal ini.

Luruskan niat. Perbanyak dan optimalkan ikhtiar. Hilangkan penyakit hati. Sering kali kita sendirilah yang membuat rasa cemas terjadi pada diri kita. Juga kita sendiri yang memilih terjadinya kesusahan dan kesedihan. Penyakit ini tentu bukan karena virus akan tetapi penyakit akibat adanya kerusakan pikiran kita dan akibat sedikitnya iman kita kepada Tuhan.

Cintailah orang lain seperti mencintai diri sendiri. Kalimat sederhana itu bermakna dalam karena merupakan hal yang dapat membawa kebahagiaan bagi jiwa manusia. Ketika kita mencintai saudara kita seperti kita mencintai diri sendiri, dada kita akan terasa lapang. Jiwa kita terasa tenang dan kita akan merasakan puncak kepuasan.

Kebahagiaan kita menjadi bertambah ketika kita menanggalkan titik-titik hitam. Titik-titik hitam ini bisa berupa rasa dengki, iri, benci, dendam, dan sebagainya. Jangan bersedih dengan masa lalu. Pikirkan dan  laksanakan masa kini. Persiapkan diri untuk masa depan.

Adanya perasaan sedih karena masa lalu, juga karena mengingat peristiwa masa lalu yang tidak mungkin kembali lagi merupakan suatu kelemahan yang akan menjadikan seseorang terus merasa terus terbelenggu dan hanya akan menjadikannya lemah dan tak berdaya. Hal-hal seperti itulah yang dapat saya dapat dari kuliah kimia dan masyarakat pada waktu itu.

Sebelumnya saya juga tidak menduga bahwa Bu Neli adalah seorang direktur. Karena menurut hemat saya Beliau itu kelihatan tidak mempunyai wajah seorang direktur. Mungkin juga teman-teman yang lain berpendapat hal yang sama dengan penulis.

Tapi pikiran yang harus saya hilangkan adalah menilai orang lain dari segi penampilannya. Walaupun penampilannya tidak mirip seorang direktur tetapi Bu Neli mempunyai nilai-nilai yang mungkin saja melebihi daripada direktur kebanyakan yaitu nilai ketekunan, kerja keras, berjiwa besar dan berpikiran positif. Hal tesebut adalah sesuatu modal berharga yang harus dimiliki oleh setiap orang termasuk harus dimiliki oleh penulis.

Evaluasi  perkuliahan ini dari penulis sedikit saja karena menurut penulis palaksanaan kuliah kimia dan pada masyarakat  pada hari Jumat yang lalu sudah baik. Host person yaitu Gde Sutawijaya telah mengemasnya dengan baik  sehingga saya merasa puas  dengan kuliah pada waktu itu.

Mungkin saja  karena Gde Sutawijaya telah berpenampilan begitu trendy penampilan Bu Mega dan Bu Neli yang cukup modis seperti biasanya sehingga memberikan sugesti positif pada perkuliahan.

Daftar Pustaka

AnandaRaoa, R.,Swaminathana, S., Fernandob, S., Jana, A.M., Khannaa, N., (2005), A custom-designed recombinant multiepitope protein as a dengue diagnostic reagent, Protein Expression and Purification, 41, 136–147.

AnandaRaoa, R.,Swaminathana, S., Fernandob, S., Jana, A.M., Khannaa, N., (2006), Recombinant Multiepitope Protein for Early Detection of Dengue Infections, American Society for Microbiology, 13, 59-67.

K.I. Yamada, T. Takasaki, M. Nawa, I. Kurane, Virus isolation as one of the diagnostic methods for dengue virus infection, J. Clin.Virol. 24 (2002) 203–209.

J. Groen, P. Koraka, J. Velzing, C. Copra, A.D.M.E. Osterhaus,Evaluation of six immunoassays for detection of dengue virus speciWc immunoglobulin M and G antibodies, Clin. Diagn. Lab.

Immunol. 7 (2000) 867–871.

A.J. Cuzzubbo, T.P. Endy, A. Nisalak, S. Kalyanarooj, D.W. Vaughn,S.A. Ogata, D.E. Clements, P.L. Devine, Use of recombinantenvelope proteins for serological diagnosis of dengue virus infectionin an immunochromatographic assay, Clin. Diagn. Lab.Immunol. 8 (2001) 1150–1155.

Rady R. Dypatra, Proposal Penelitian, Kloning Gen Pengkode Epitop IgG Dengue, (2009).

Iman Prawira, Proposal penelitian, Konstruksi antigen rekombinan dengue yang spesifik terhadap antibodi IgG dan IgM, (2008).

http://newsgroups.derkeiler.com/pdf/Archive/Soc/soc.culture.indonesia/2006-09/msg00061.pdf

http://yudistira-himura-naruto.blogspot.com/2009/03/pendidikan-rumah-berperan-dalam.html

http://www.islamonline.net

http://www.cdc.gov

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s